http://www.nap.edu/catalog/11026.

html
We ship printed books within 1 business day; personal PDFs are available immediately.

The Infectious Etiology of Chronic Diseases:

Defining the Relationship, Enhancing the Research,
and Mitigating the Effects -- Workshop Summary
Stacey L. Knobler, Siobhan O'Connor, Stanley M.
Lemon, Marjan Najafi, Editors, Forum on Microbial
Threats
ISBN: 0-309-52672-8, 236 pages, 6 x 9, (2004)
This PDF is available from the National Academies Press at:
http://www.nap.edu/catalog/11026.html

Visit the National Academies Press online, the authoritative source for all books
from the National Academy of Sciences, the National Academy of Engineering,
the Institute of Medicine, and the National Research Council:
• Download hundreds of free books in PDF
• Read thousands of books online for free
• Explore our innovative research tools – try the “Research Dashboard” now!
• Sign up to be notified when new books are published
• Purchase printed books and selected PDF files

Thank you for downloading this PDF. If you have comments, questions or
just want more information about the books published by the National
Academies Press, you may contact our customer service department toll-
free at 888-624-8373, visit us online, or send an email to
[email protected].

This book plus thousands more are available at http://www.nap.edu.

Copyright © National Academy of Sciences. All rights reserved.
Unless otherwise indicated, all materials in this PDF File are copyrighted by the National
Academy of Sciences. Distribution, posting, or copying is strictly prohibited without
written permission of the National Academies Press. Request reprint permission for this book.
The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

THE INFECTIOUS
ETIOLOGY OF
CHRONIC DISEASES
Defining the Relationship,
Enhancing the Research, and
Mitigating the Effects

Workshop Summary

Stacey L. Knobler, Siobhán O’Connor, Stanley M. Lemon,

Marjan Najafi, Editors

Forum on Microbial Threats

Board on Global Health

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

THE NATIONAL ACADEMIES PRESS 500 Fifth Street, NW Washington, DC 20001

NOTICE: The project that is the subject of this report was approved by the Governing Board of
the National Research Council, whose members are drawn from the councils of the National
Academy of Sciences, the National Academy of Engineering, and the Institute of Medicine.
Support for this project was provided by the U.S. Department of Health and Human Services’
National Institutes of Health, Centers for Disease Control and Prevention, and Food and Drug
Administration; U.S. Agency for International Development; U.S. Department of Defense; U.S.
Department of State; U.S. Department of Veterans Affairs; U.S. Department of Agriculture;
American Society for Microbiology; Burroughs Wellcome Fund; Ellison Medical Foundation;
Pfizer; GlaxoSmithKline; and The Merck Company Foundation. The views presented in this
report are those of the editors and attributed authors and are not necessarily those of the funding
agencies.
This report is based on the proceedings of a workshop that was sponsored by the Forum on
Microbial Threats. It is prepared in the form of a workshop summary by and in the name of the
editors, with the assistance of staff and consultants, as an individually authored document. Sec-
tions of the workshop summary not specifically attributed to an individual reflect the views of
the editors and not those of the Forum on Microbial Threats. The content of those sections is
based on the presentations and the discussions that took place during the workshop.
International Standard Book Number 0-309-08994-8 (Book)
International Standard Book Number 0-309-52673-6 (PDF)
Library of Congress Control Number: 2004107939
Additional copies of this report are available from the National Academies Press, 500 Fifth
Street, NW, Lockbox 285, Washington, DC 20055; (800) 624-6242 or (202) 334-3313 (in the
Washington metropolitan area); Internet, http://www.nap.edu.
For more information about the Institute of Medicine, visit the IOM home page at:
www.iom.edu.
Copyright 2004 by the National Academy of Sciences. All rights reserved.
Printed in the United States of America.
The serpent has been a symbol of long life, healing, and knowledge among almost all cultures
and religions since the beginning of recorded history. The serpent adopted as a logotype by the
Institute of Medicine is a relief carving from ancient Greece, now held by the Staatliche Museen
in Berlin.
COVER: The background for the cover of this workshop summary is a photograph of a batik
designed and printed specifically for the Malaysian Society of Parasitology and Tropical Medi-
cine. The print contains drawings of various parasites and insects; it is used with the kind
permission of the Society.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

“Knowing is not enough; we must apply.

Willing is not enough; we must do.”
—Goethe

Adviser to the Nation to Improve Health

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

The National Academy of Sciences is a private, nonprofit, self-perpetuating society of

distinguished scholars engaged in scientific and engineering research, dedicated to the
furtherance of science and technology and to their use for the general welfare. Upon the
authority of the charter granted to it by the Congress in 1863, the Academy has a mandate
that requires it to advise the federal government on scientific and technical matters. Dr.
Bruce M. Alberts is president of the National Academy of Sciences.

The National Academy of Engineering was established in 1964, under the charter of
the National Academy of Sciences, as a parallel organization of outstanding engineers. It
is autonomous in its administration and in the selection of its members, sharing with the
National Academy of Sciences the responsibility for advising the federal government.
The National Academy of Engineering also sponsors engineering programs aimed at
meeting national needs, encourages education and research, and recognizes the superior
achievements of engineers. Dr. Wm. A. Wulf is president of the National Academy of
Engineering.

The Institute of Medicine was established in 1970 by the National Academy of Sci-
ences to secure the services of eminent members of appropriate professions in the exami-
nation of policy matters pertaining to the health of the public. The Institute acts under the
responsibility given to the National Academy of Sciences by its congressional charter to
be an adviser to the federal government and, upon its own initiative, to identify issues of
medical care, research, and education. Dr. Harvey V. Fineberg is president of the Insti-
tute of Medicine.

The National Research Council was organized by the National Academy of Sciences in
1916 to associate the broad community of science and technology with the Academy’s
purposes of furthering knowledge and advising the federal government. Functioning in
accordance with general policies determined by the Academy, the Council has become the
principal operating agency of both the National Academy of Sciences and the National
Academy of Engineering in providing services to the government, the public, and the
scientific and engineering communities. The Council is administered jointly by both Acad-
emies and the Institute of Medicine. Dr. Bruce M. Alberts and Dr. Wm. A. Wulf are chair
and vice chair, respectively, of the National Research Council.

www.national-academies.org

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

FORUM ON MICROBIAL THREATS

ADEL MAHMOUD (Chair), President, Merck Vaccines, Whitehouse Station,

New Jersey
STANLEY LEMON (Vice-Chair), Dean, School of Medicine, University of
Texas Medical Branch, Galveston
DAVID ACHESON, Chief Medical Officer, Center for Food Safety and
Applied Nutrition, Food and Drug Administration, Rockville, Maryland
STEVEN BRICKNER, Research Advisor, Pfizer Global Research and
Development, Pfizer Inc., Groton, Connecticut
DENNIS CARROLL, U.S. Agency for International Development,
Washington, DC
NANCY CARTER-FOSTER, Director, Program for Emerging Infections and
HIV/AIDS, U.S. Department of State, Washington, DC
GAIL CASSELL, Vice President, Scientific Affairs, Eli Lilly & Company,
Indianapolis, Indiana
JESSE GOODMAN, Deputy Director, Center for Biologics Evaluation and
Research, Food and Drug Administration, Rockville, Maryland
EDUARDO GOTUZZO, Director, Instituto de Medicina Tropical–Alexander
von Humbolt, Universidad Peruana Cayetano Heredia, Lima, Peru
MARGARET HAMBURG, Vice President for Biological Programs, Nuclear
Threat Initiative, Washington, DC
CAROLE HEILMAN, Director, Division of Microbiology and Infectious
Diseases, National Institute of Allergy and Infectious Diseases, National
Institutes of Health, Bethesda, Maryland
DAVID HEYMANN, Executive Director, Communicable Diseases, World
Health Organization, Geneva, Switzerland
JAMES HUGHES, Assistant Surgeon General and Director, National Center
for Infectious Diseases, Centers for Disease Control and Prevention,
Atlanta
LONNIE KING, Dean, College of Veterinary Medicine, Michigan State
University, East Lansing
JOSHUA LEDERBERG, Raymond and Beverly Sackler Foundation Scholar,
Rockefeller University, New York
JOSEPH MALONE, Director, Department of Defense Global Emerging
Infections System, Walter Reed Army Institute of Research, Silver Spring,
Maryland
LYNN MARKS, Senior Vice President of Infectious Diseases, Medicine
Development Center, GlaxoSmithKline, Collegeville, Pennsylvania
STEPHEN MORSE, Director, Center for Public Health Preparedness,
Columbia University, New York

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

MICHAEL OSTERHOLM, Director, Center for Infectious Disease Research

and Policy and Professor, School of Public Health, University of
Minnesota, Minneapolis
GEORGE POSTE, Director, Arizona BioDesign Institute, Arizona State
University, Tempe
GARY ROSELLE, Program Director for Infectious Diseases, VA Central
Office, Veterans Health Administration, Department of Veterans Affairs,
Washington, DC
JANET SHOEMAKER, Director, Office of Public Affairs, American Society
for Microbiology, Washington, DC
P. FREDRICK SPARLING, J. Herbert Bate Professor Emeritus of Medicine,
Microbiology, and Immunology, University of North Carolina, Chapel Hill

Liaisons
YVES BERGEVIN, Department of Child and Adolescent Health and
Development, World Health Organization, Geneva, Switzerland
ENRIQUETA BOND, President, Burroughs Wellcome Fund, Research
Triangle Park, North Carolina
EDWARD McSWEEGAN, National Institute of Allergy and Infectious
Diseases, National Institutes of Health, Bethesda, Maryland

Staff
STACEY KNOBLER, Director, Forum on Microbial Threats
MARJAN NAJAFI, Research Associate
KATHERINE OBERHOLTZER, Research Assistant

vi

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

BOARD ON GLOBAL HEALTH

DEAN T. JAMISON, (Chair), Senior Fellow, Fogarty International Center,

National Institutes of Health, Bethesda, Maryland
JAIME SEPÚLVEDA AMOR, National Institute of Public Health, Mexico
YVES BERGEVIN, Department of Child and Adolescent Health and
Development, World Health Organization, Geneva, Switzerland
JO IVEY BOUFFORD, Professor, Robert F. Wagner School of Public
Service, New York University, New York
RICHARD FEACHEM, Executive Director, Global Fund to Fight AIDS,
Tuberculosis and Malaria, Geneva, Switzerland
MARGARET HAMBURG, Vice President for Biological Programs, Nuclear
Threat Initiative, Washington, DC
GERALD T. KEUSCH, Assistant Provost for Global Health, Medical Center,
and Associate Dean for Global Health, Boston University School of Public
Health, Boston
JEFFREY KOPLAN, Vice President for Academic Health Affairs, Emory
University, Atlanta
ADEL A.F. MAHMOUD, President, Merck Vaccines, Whitehouse Station,
New Jersey
MAMPHELA A. RAMPHELE, Managing Director, The World Bank,
Washington, DC
MARK L. ROSENBERG, Executive Director, The Task Force for Child
Survival and Development, Emory University, Atlanta
DONALD M. BERWICK, (IOM Council Liaison), Clinical Professor of
Pediatrics and Health Care Policy, Harvard Medical School; and President
and CEO, Institute of Healthcare Improvement, Boston
DAVID R. CHALLONER, (IOM Foreign Secretary), Vice President for
Health Affairs, Emeritus, University of Florida, Gainesville

Staff
PATRICK KELLEY, Director
MONISHA ARYA, Policy Intern
HARRIET BANDA, Senior Project Assistant
ALLISON BERGER, Senior Project Assistant
STACEY KNOBLER, Senior Program Officer
MARJAN NAJAFI, Research Associate (through November 2003)
KATHERINE OBERHOLTZER, Research Assistant
LAURA SIVITZ, Research Associate
DIANNE STARE, Research Assistant/Administrative Assistant

vii

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

Reviewers

All presenters at the workshop have reviewed and approved their respective
sections of this report for accuracy. In addition, this workshop summary has been
reviewed in draft form by independent reviewers chosen for their diverse per-
spectives and technical expertise, in accordance with procedures approved by the
National Research Council’s Report Review Committee. The purpose of this in-
dependent review is to provide candid and critical comments that will assist the
Institute of Medicine (IOM) in making the published workshop summary as sound
as possible and to ensure that the workshop summary meets institutional stan-
dards. The review comments and draft manuscript remain confidential to protect
the integrity of the deliberative process.

The Forum and IOM thank the following individuals for their participation in
the review process:

Paul Eke, Centers for Disease Control and Prevention, Chamblee, Georgia
Charlotte Gaydos, Johns Hopkins University School of Medicine, Balti-
more, Maryland
Julie Parsonnet, Stanford University School of Medicine, Palo Alto, Cali-
fornia
David Relman, Veterans Administration Palo Alto Health Care System, Palo
Alto, California
Donald Silberberg, University of Pennsylvania School of Medicine, Phila-
delphia

ix

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

x REVIEWERS

The review of this report was overseen by Melvin Worth, M.D., Scholar-in-
Residence, National Academies, who was responsible for making certain that an
independent examination of this report was carried out in accordance with institu-
tional procedures and that all review comments were carefully considered. Re-
sponsibility for the final content of this report rests entirely with the editors and
individual authors.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

Preface

The Forum on Microbial Threats was created in 1996 in response to a request

from the Centers for Disease Control and Prevention and the National Institutes
of Health. The goal of the Forum is to provide structured opportunities for repre-
sentatives from academia, industry, professional and interest groups, and govern-
ment to examine and discuss scientific and policy issues that are of shared inter-
est and that are specifically related to research and prevention, detection, and
management of emerging infectious diseases. In accomplishing this task, the Fo-
rum provides the opportunity to foster the exchange of information and ideas,
identify areas in need of greater attention, clarify policy issues by enhancing
knowledge and identifying points of agreement, and inform decision makers about
science and policy issues. The Forum seeks to illuminate issues rather than re-
solve them directly; hence, it does not provide advice or recommendations on any
specific policy initiative pending before any agency or organization. Its strengths
are the diversity of its membership and the contributions of individual members
expressed throughout the activities of the Forum.

ABOUT THE WORKSHOP

The belief that many long-recognized chronic diseases are infectious in ori-
gin goes back to the mid-nineteenth century, when cancer was studied as a pos-
sible infectious disease. In the 1950s and 1960s, much biomedical research was
directed, unsuccessfully, at the identification of microorganisms purportedly caus-
ing a variety of chronic diseases. In recent years the picture has begun to change.
One chronic disease after another has been linked, in some cases definitively, to

xi

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

xii PREFACE

an infectious etiology (e.g., peptic ulcer disease with Helicobacter pylori, cervi-
cal cancer with several human papillomaviruses, Whipple’s disease with
Tropheryma whippeli, Lyme arthritis and neuroborreliosis with Borrelia
burgdorferi, AIDS with HIV). Evidence implicating microorganisms as etiologic
agents of chronic diseases with substantial mortality and morbidity impact, in-
cluding atherosclerosis and cardiovascular disease, diabetes mellitus, inflamma-
tory bowel disease, and a variety of neurological and neuropsychiatric diseases,
continues to mount.
Emerging infectious diseases are conceptualized as either newly identified or
appreciated illnesses, conditions, or well-recognized diseases that are newly at-
tributed to infection. Now, scientists are beginning to believe that a substantial
portion of chronic diseases may actually be associated with infection.
In an effort to identify cross-disciplinary aspects of the challenge of infec-
tious etiologies of chronic diseases, including inflammatory syndromes and can-
cer, the Institute of Medicine’s Forum on Microbial Threats hosted a two-day
workshop on October 21–22, 2002. The workshop, Linking Infectious Agents
and Chronic Diseases, explored the factors that drive infectious etiologies of
chronic diseases to prominence, and sought to identify more broad-based strate-
gies and research programs that need to be developed. The goals of the workshop
were to:

1. Review the range of pathogenic mechanisms and diversity of etiologic

microbes and chronic diseases, including inflammatory syndromes and cancer;
2. Explore trends, advances, and gaps in collaborative research on diagnos-
tic technologies, and their integration into epidemiologic studies and surveillance;
3. Identify chronic diseases and syndromes that warrant further investiga-
tion;
4. Identify research needed to clarify the etiologic agents and pathogenic
mechanisms involved in chronic diseases, screening for multiple potential agents
of the same outcome, and considering that one microbe might induce multiple
syndromes;
5. Identify the principal bottlenecks and opportunities to detect, prevent, and
mitigate the impact of chronic diseases on human health against the overall back-
drop of emerging infections;
6. Consider the benefits and risks of early detection and prevention of chronic
diseases caused by infectious agents.

The issues pertaining to these goals were addressed through invited presenta-
tions and subsequent discussions, which highlighted ongoing programs and ac-
tions taken, and also identified the most vital needs in this important area.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

PREFACE xiii

ORGANIZATION OF WORKSHOP SUMMARY

This workshop summary report is prepared for the Forum membership in the
name of the editors, with the assistance of staff and consultants, as a collection of
individually authored papers. Sections of the workshop summary not specifically
attributed to an individual reflect the views of the editors and not those of the
Forum on Microbial Threats’ sponsors or the Institute of Medicine (IOM). The
contents of the unattributed sections are based on the presentations and discus-
sions that took place during the workshop.
The workshop summary is organized within chapters as a topic-by-topic de-
scription of the presentations and discussions. Its purpose is to present lessons
from relevant experience, delineate a range of pivotal issues and their respective
problems, and put forth some potential responses as described by the workshop
participants. The Summary and Assessment chapter discusses the core messages
that emerged from the speakers’ presentations and the ensuing discussions. Chap-
ters 1 through 4 begin with overviews provided by the editors, followed by
authored papers that reflect the topics and findings of the authors’ workshop pre-
sentations. Chapter 1 presents case studies of infectious agents that have been
shown to be associated with chronic diseases. Chapter 2 illustrates implications
for developing countries where many infectious diseases remain endemic. Chap-
ter 3 describes methodologies currently used in this area of research. Chapter 4
presents strategies to prevent and mitigate the impact of chronic diseases caused
by infectious agents. Appendix A presents the workshop agenda. Appendix B is a
list of information resources that review the relationship between infections and
chronic diseases. Appendix C presents Forum member and speaker biographies.
Although this workshop summary provides an account of the individual pre-
sentations, it also reflects an important aspect of the Forum philosophy. The work-
shop functions as a dialogue among representatives from different sectors and
presents their beliefs on which areas may merit further attention. However, the
reader should be aware that the material presented here expresses the views and
opinions of those participating in the workshop and not the deliberations of a
formally constituted IOM study committee. These proceedings summarize only
what participants stated in the workshop and are not intended to be an exhaustive
exploration of the subject matter.

ACKNOWLEDGMENTS
The Forum on Microbial Threats and the IOM wish to express their warmest
appreciation to the individuals and organizations who gave valuable time to
provide information and advice to the Forum through their participation in the
workshop.
The Forum is indebted to the IOM staff who contributed their time and efforts
in planning and executing the workshop and the production of this workshop

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

xiv PREFACE

summary. On behalf of the Forum, we gratefully acknowledge the efforts led by

Stacey Knobler, director of the Forum, and Marjan Najafi, research associate,
coeditors of this report, who dedicated much effort and time to developing this
workshop’s agenda, and for their thoughtful and insightful approach and skill in
translating the workshop proceedings and discussion into this workshop sum-
mary. We would also like to thank the following Academies staff and consultants
for their valuable contributions to this activity: Rob Coppock, Tom Burroughs,
Carlos Orr, Jennifer Bitticks, Bronwyn Schrecker, Sally Stanfield, Rachel Marcus,
Beth Gyorgy, Patricia Cuff, Katherine Oberholtzer, and Laura Sivitz.
Finally, the Forum also thanks sponsors that supported this activity. Finan-
cial support for this project was provided by the U.S. Department of Health and
Human Services’ National Institutes of Health, Centers for Disease Control and
Prevention, and Food and Drug Administration; U.S. Agency for International
Development; U.S. Department of Defense; U.S. Department of State; U.S.
Department of Veterans Affairs; U.S. Department of Agriculture; American
Society for Microbiology; Burroughs Wellcome Fund; Ellison Medical Founda-
tion; Pfizer; GlaxoSmithKline; and The Merck Company Foundation. The views
presented in this workshop summary are those of the editors and workshop par-
ticipants and are not necessarily those of the funding organizations.

Adel A.F. Mahmoud, Chair

Stanley M. Lemon, Vice-Chair
Forum on Microbial Threats

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

Contents

SUMMARY AND ASSESSMENT 1

Stanley M. Lemon and Siobhán O’Connor

1 DEFINING THE RELATIONSHIP: AN EXAMINATION 13

OF INFECTIOUS AGENTS ASSOCIATED WITH
CHRONIC DISEASES
Overview, 13
The Role of Viruses in Oncogenesis: Human Papillomaviruses and
Cervical Cancer as a Paradigm, 17
Eduardo L. Franco
Chronic Hepatitis B Virus Infections, 28
William Mason
Infectious Agents and Cardiovascular Disease, 36
Michael Dunne
Demyelinating Diseases, 45
Richard T. Johnson
Common Infections and Uncommon Disease: Elusive Associations
of Enteroviruses and Type I Diabetes Mellitus, 52
Mark A. Pallansch and M. Steven Oberste
Infectious Agents and Schizophrenia, 59
Robert H. Yolken and E. Fuller Torrey
Ovine Pulmonary Adenocarcinoma: Identifying the Causative Agent
for a Neoplastic Disease and Implications for Human Lung Cancer, 66
Hung Fan
Propionibacterium acnes and Chronic Diseases, 74
Ajay Bhatia, Jean-Francoise Maisonneuve, and David H. Persing

xv

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

xvi CONTENTS

2 ENDEMIC INFECTIOUS DISEASES LINKED TO 81

CHRONIC DISEASES: IMPLICATIONS FOR
DEVELOPING COUNTRIES
Overview, 81
Potential Long-Term Consequences of Early Childhood Enteric and
Parasitic Infections, 83
Richard L. Guerrant, Aldo A.M. Lima, Sean R. Moore, Breyette Lorntz,
and Peter Patrick
Infectious Agents and Epilepsy, 93
Josemir W. Sander
Control of Infectious Causes of Childhood Disability in Developing
Countries, 99
Maureen Durkin
HTLV-1: Clinical Impact of a Chronic Infection, 110
Eduardo Gotuzzo and Kristien Verdonck
Progression of Hepatitis C Virus Infection with and Without
Schistosomiasis, 120
Sanaa Kamal
Interactions of Multiple Infectious Agents in Malaria-Endemic Areas:
Concurrent HIV/AIDS and Malaria, 126
Altaf A. Lal

3 OBSTACLES AND OPPORTUNITIES FOR FRAMING 135

FUTURE RESEARCH
Overview, 135
Pathogens and Disease: Issues in Determining Causality, 140
Patrick S. Moore
Exploring the Genetic Background–Environment Interplay in an
Animal Model of Neurodevelopmental Disorders:
A Multidisciplinary Approach, 150
Mikhail V. Pletnikov
Infection, Cancer, and the Immune Response, 154
David H. Persing and Franklyn G. Prendergast

4 OPPORTUNITIES TO PREVENT AND MITIGATE THE 174

IMPACT OF CHRONIC DISEASES CAUSED BY
INFECTIOUS AGENTS
Overview, 174
Developing Vaccines for Prevention of Chronic Disease, 175
P. Helena Mäkelä
Toward a Strategic Approach: Integrating Epidemiology,
Laboratory Research, and Surveillance; Setting Priorities, 183
Siobhán O’Connor

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

CONTENTS xvii

APPENDIXES

A Workshop Agenda 187

B Information Resources 192

C Biosketches 194
Members of the Forum on Microbial Threats, 194
Speakers, 205
Forum Staff, 215

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

Summary and Assessment

The belief that infectious agents may cause certain chronic diseases can be
traced to the mid-19th century, when cancer was studied as a possible infectious
disease. This effort met with little success. In the 1950s and 1960s, much more
biomedical research was directed, again unsuccessfully, at the identification of
microorganisms purported to cause a variety of chronic diseases. In recent years,
however, the picture has begun to change. A number of chronic diseases have
now been linked, in some cases definitively, to an infectious etiology: peptic
ulcer disease with Helicobacter pylori, cervical cancer with several human
papillomaviruses, Whipple’s disease with Tropheryma whipplei, Lyme arthritis
and neuroborreliosis with Borrelia burgdorferi, AIDS with the human immuno-
deficiency virus, liver cancer and cirrhosis with hepatitis B and C viruses, to
name a few. Indeed, evidence continues to mount implicating microorganisms as
etiologic agents of chronic diseases that have substantial morbidity and mortality,
including atherosclerosis and cardiovascular disease, type 1 diabetes, inflamma-
tory bowel disease, and a variety of neurological diseases. The proven and sus-
pected roles of microbes does not stop with physical ailments; infections are in-
creasingly being examined as associated causes of or possible contributors to a
variety of serious, chronic neuropsychiatric disorders and to developmental prob-
lems, especially in children.
It also has become apparent that multiple pathogens sometimes interact in
causing chronic diseases or rendering them more virulent. For example, people
who have concomitant infection with hepatitis C virus and the organism that
causes schistosomiasis—as many individuals do in some developing countries—
often develop schistosomiasis much more rapidly than do people who are not

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

2 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

coinfected. Exploring such pathogen interactions and their effects on the immune
system represent rapidly burgeoning areas of scientific interest.1
This report summarizes a two-day workshop held by the Institute of
Medicine’s Forum on Microbial Threats on October 21–22, 2002, to address this
rapidly evolving field. Invited experts presented research findings on a range of
recognized and potential chronic sequelae of infections, as well as on diverse
pathogenic mechanisms leading from exposure to chronic disease outcomes. Can-
cers, cardiovascular disease, demyelinating syndromes, neuropsychiatric diseases,
hepatitis, and type 1 diabetes were among the conditions addressed. Participants
explored factors driving infectious etiologies of chronic diseases of prominence,
identified difficulties in linking infectious agents with chronic outcomes, and dis-
cussed broad-based strategies and research programs to advance the field. Table
S-1 lists the infectious agents and associated diseases discussed in this report.
Emerging infectious diseases are conceptualized either as newly identified or
appreciated infectious illnesses and conditions, or as previously recognized syn-
dromes that are newly attributed to infection. Some scientists now believe that a
substantial portion of chronic diseases may be causally linked to infectious agents.
Just as the germ theory opened the way for numerous discoveries about the
sources of acute infections, changing ideas about the nature of both infectious
diseases and chronic diseases, coupled with the advent of powerful new labora-
tory techniques, are leading to novel claims concerning the infectious origins of
chronic diseases.

DEFINING THE RELATIONSHIP

The traditional standards for establishing a microbial or bacterial cause of
disease are those that were developed for acute infections. Known as “Koch’s
postulates,” they state that the causal organism must be:

1. present in diseased tissue;

2. isolated and grown in pure culture outside the animal host;
3. shown to induce the same disease when injected into a healthy animal;
and
4. isolated from the experimentally inoculated animal in pure culture and
shown to be the same as the original agent.

1It should be clearly noted throughout this summary report that the nature of the evidence for

causality of a chronic disease from an infectious agent varies considerably. Each of the cases re-
viewed here represents a wide spectrum of the nature of the relationship between the infectious agent
and the chronic disease. In some cases, the links are definitive (e.g., human papillomavirus and cervi-
cal cancer). In other cases, the relationship has only recently been investigated with little more than
suspected associations from preliminary data (e.g., enteroviruses and Type I diabetes).

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

SUMMARY AND ASSESSMENT 3

TABLE S-1 Possible Infectious Etiologies for Chronic Diseases Discussed at

the Workshop
Infectious Agent Chronic Disease/Condition Chapter
Human papillomavirus Cervical cancer 1
Hepatitis B virus • Liver cancer
• Cirrhosis 1
Chlamydia pneumoniae Atherosclerosis 1
Vaccinia virus Postinfectious encephalomyelitis or acute 1
disseminated encephalomyelitis (ADEM)
JC virus Progressive multifocal leucoencephalopathy 1
(PML)
Various viruses Multiple sclerosis 1
Enteroviruses Type I diabetes mellitus 1
Toxoplasma gondii Schizophrenia 1
Herpes Simplex virus Type 2 Schizophrenia 1
Jaagsiekte sheep retrovirus (JSRV) Ovine pulmonary adenocarcinoma 1
Propionibacterium acnes • Chronic inflammatory acne
• Other chronic diseases 1
Cryptosporidiosis and intestinal Disability consequences including growth 2
helminthic infections shortfalls, fitness and cognitive impairment
Helminthic infections Epilepsy 2
Plasmodium falciparum Epilepsy 2
Treponema pallidum Congenital syphilis 2
Toxoplasma gondii Congenital toxoplasmosis 2
Maternal rubella virus Congenital rubella 2
Perinatal HIV Developmental disabilities 2
Perinatal herpes viruses Neurodevelopmental disabilities 2
Plasmodium falciparum • Cognitive development
• Childhood anemia 2
Haemophilus influenzae Nervous system impairment 2
Type B meningitis
Japanese encephalitis virus Neuropsychiatric sequelae 2
Measles virus Developmental disabilities 2
Poliovirus Paralysis
Chlamydia trachomatis Trachoma
Human T-cell lymphotropic • Adult T-cell leukemia/lymphoma 2
virus Type 1 • Autoimmune disorders
• Infections associated with immunosuppression
Human herpes virus Type 8 Kaposi’s sarcoma 3
Borna disease virus Neurodevelopmental disorders 3
Hepatitis C virus and Schistosoma
mansoni interaction 2
HIV and Plasmodium falciparum
interaction 2

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

4 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

In almost all cases, identifying and confirming an infectious cause of a

chronic disease using Koch’s postulates is complicated by several factors, includ-
ing:

• Disease etiology may be multifactorial, including environmental, host

genetic, and microbial genomic factors. Michael Dunne (Chapter 1) surveys a
number of pathogens proposed to contribute to atherosclerosis and cardiovascu-
lar disease. Chlamydia pneumoniae, cytomegalovirus, and herpes simplex virus
are among the suggested bacterial and viral pathogens, with the greatest body of
evidence surrounding C. pneumoniae. Yet in all of these cases, when these agents
are considered in the context of well-established risk factors for cardiovascular
disease—family history, high-fat diet, inactivity—it is less clear how much infec-
tion would truly contribute to the condition and the outcome. Eduardo Franco
(Chapter 1) describes the association that has been found between human papil-
lomavirus and cervical cancer. Even years after discovery of this link, however,
questions remain about the roles of cofactors, as only some of the many people
infected develop malignancy.
• Microorganisms may act in a hit-and-run fashion, striking and then disap-
pearing from the host by the time the disease process becomes apparent. This
form of attack appears to be the case in Reiter’s syndrome, Guillain-Barré syn-
drome, and rheumatic heart disease. As another example, Robert Yolken and
Fuller Torrey (Chapter 1) report that a retrospective study of schizophrenics found
that their mothers’ blood at the time of birth exhibited elevated IgG, IgM, and
certain cytokines, suggesting that an ongoing inflammatory process may possibly
be associated with Toxoplasma infection. Antibodies directed against endogenous
retroviruses, including Herv-W, have also been found at elevated levels. Infec-
tion in the perinatal period may have set the stage for later neurological disease,
although there may be little or no evidence of active infection at the time of
diagnosis.
• Acute, chronic, latent, or recurrent infections may be involved in patho-
genesis, and coinfections may play a critical role in disease manifestation. Rich-
ard Johnson (Chapter 1) describes postinfectious encephalomyelitis in which pa-
tients develop fever, become obtunded, and develop multifocal neurological signs
several days after resolution of an acute rash caused by a virus. This is an ex-
ample of an acute systemic disease with a postinfectious immune response lead-
ing to demyelination within the central nervous system. In other cases, a long
period of active viral replication may precede the onset of disease. William Ma-
son (Chapter 1) reports that the risk of developing chronic hepatitis B virus infec-
tion is greater than 90 percent when a person is infected at birth or in early child-
hood, but drops to less than 10 percent when a person is infected as an adult. In
such chronic infections, the risk of fatal liver disease (cirrhosis or liver cancer)
rises to approximately 25 percent, with a 30 year to 50 year interval between the
onset of the infection and the consequent pathological outcome. A similar picture

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

SUMMARY AND ASSESSMENT 5

occurs with hepatitis C virus infection, although in this case there is virus persis-
tence when the infection occurs in adulthood. Viral infections may also be latent
at the time of diagnosis. For example, there are several viruses for which patients
with multiple sclerosis (MS) exhibit higher antibody levels than control patients.
Johnson reports on one study which revealed that 23 percent of MS patients had
antibodies to two or more viruses present within their central nervous systems,
with one patient presenting with 11 viruses. It is not yet clear whether infection(s)
triggers MS or whether elevated markers of infection are secondary to the under-
lying inflammatory processes of the disease. Such findings emphasize the com-
plexity of directly attributing chronic disease to one or more specific infectious
agents.
• Detecting and/or isolating microbes that are present in a variety of tissues
may pose significant technical difficulties. Current methods to identify novel or
rare microorganisms may be inadequate. During the workshop, David Persing
reported on the deficiencies and weaknesses of conventional methods for identi-
fying and subtyping microorganisms. However, newer molecular technology,
such as broad-range amplification of ribosomal targets directly from tissue or
culture, can complement conventional systems, and these tools have helped in
identifying several new species and pathogenic subtypes. For example, the infec-
tious agent strongly suspected of causing Whipple’s disease remained elusive for
years. Applying broad-range polynuclear chain reaction techniques enabled sci-
entists to amplify and categorize the etiologic Tropheryma whipplei bacterium.
Patrick Moore (Chapter 3) recounts the development of a technique called repre-
sentational difference analysis to identify Kaposi’s sarcoma-associated herpesvi-
rus as a cause of AIDS-associated Kaposi’s sarcoma. These discoveries exem-
plify the diligent effort required to move from identification of a new DNA
sequence to confirming causality in a specific disease. During the workshop,
Persing also described the potential for gene expression arrays (microarrays),
proteomics, and other technologies to identify patterns of host response to an
infection(s) that might explain the pathogenic processes from exposure to chronic
disease and lead to the development of diagnostic tools for these entities. Phylo-
genetic analysis can relate new pathogens for which there are no effective diag-
nostic assays to known agents through conserved epitopes and other properties,
facilitating the evaluation of new infectious causes of disease.

Given the various reasons why it may often prove difficult to satisfy Koch’s
postulates in linking a particular infectious agent to a particular chronic disease,
alternative sets of criteria may need to be developed for determining causation.
Such criteria must take into account the more complex relationships that are be-
ing observed between microbial agents and chronic disease, and they likely will
require collection of more challenging types of experimental data, especially
molecular data, that can help clarify discrete causal links. Toward this goal, sev-
eral promising avenues of research are being pursued, including extending vari-

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

6 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

ous genetic technologies and modifying animal and cell culture models of human
disease to make them more immediately relevant to microbial disease causation.
Ensuing discussions highlighted gaps in scientific knowledge and in the trans-
lation of research data to health care interventions for both well-accepted and
more speculative causal associations. Participants noted the complexity of these
issues, as well as the importance of strengthening the critical linkages among
clinicians, researchers, epidemiologists, and public health officials.

IMPLICATIONS FOR DEVELOPING COUNTRIES

Chronic diseases are a leading health issue in economically established coun-
tries, and they take a significant toll in developing countries as well. Human
T-cell lymphotropic virus type 1 infection and hepatitis C-schistosomiasis
coinfection demonstrate the impact of progressive chronic infections that already
disproportionately affect developing regions. During the next 20 years, chronic
diseases are expected to become even more important in economically develop-
ing regions, as the types of chronic conditions currently found primarily in indus-
trialized nations spread to other regions. Not only will changing economics, de-
mographic shifts with lower childhood mortality, and changing lifestyles drive
this trend, but migration from rural to urban areas and into previously uninhabited
ecosystems may expose populations to new infectious agents that underlie chronic
disease. Both newly identified and well-recognized infectious etiologies of
chronic disease, including infections known to enter a chronic state, such as tu-
berculosis and malaria, will acquire increasing importance to domestic and global
health. These associations also will create serious burdens in addition to the
chronic infection. Richard Guerrant (Chapter 2) relates that enteric and parasitic
infections, often marked by diarrhea and contributing to malnutrition, can have
long-term consequences, impairing development and cognitive abilities as well
as general health. Once again, coinfections and common acute infections are likely
to loom large and may represent an under-recognized source of chronic pathol-
ogy. Attending to the challenges imposed by chronic diseases will be difficult in
strained healthcare systems that have limited research capacity and that already
are overwhelmed by the myriad of acute health problems in developing regions.

OBSTACLES AND OPPORTUNITIES FOR FRAMING THE

RESEARCH: PRIORITIES FOR THE FUTURE
Human disease is a function of the environment in which people live and of
their genetic susceptibility to infection or its outcome. People live in concert with
a variety of microbial agents that may or may not cause disease, depending on an
individual’s exposure and surrounding environment and the genetic background
on which these are superimposed. When chronic disease stems from infectious
disease, the situation is even more complex, because it may be difficult to ascer-

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

SUMMARY AND ASSESSMENT 7

tain the precise timing of infection (which may have happened well in the past) or
the exact nature of the pathogen.
Scientifically sound data on the infectious etiologies of chronic diseases must
derive from new technologies and the optimization of existing assays. The re-
search must be guided by epidemiologic insights gained from well-designed stud-
ies of disease in human populations and from the application of sophisticated
surveillance systems to detect and monitor diseases and pathogens. Standardiza-
tion and reproducibility will be essential. Selection of appropriate cases and con-
trols is imperative, with the use of systematic case studies or experimental de-
signs when this is not possible. Prospective cohort studies should incorporate
appropriate surveillance and be capable of detecting outbreaks of infection as
well as identifying recently infected individuals. Throughout all, researchers will
need to employ comparable definitions of infection and of the chronic disease
being explored. To develop enough human capital for these endeavors, it will be
necessary to attract more scientists to the relevant fields and provide more train-
ing in attendant epidemiological and scientific areas.
Overcoming these obstacles will require the concentrated efforts of research-
ers from a variety of disciplines, including epidemiology, clinical medicine, mo-
lecular biology, and pathology, among others. It also will require harnessing new
analytical tools and approaches that have emerged recently, and continue to
emerge, from molecular biology, genomics, and biotechnology. One of the most
fruitful technologies centers on the ability to detect and manipulate nucleic acid
molecules in microorganisms, thus creating a powerful means for identifying pre-
viously unknown microbial pathogens and for studying the host-pathogen rela-
tionship. Other new tools being employed include broad-range polymerase chain
reaction and representational difference analysis, both of which have played key
roles in linking numerous pathogens with chronic diseases. Equipped with these
and other advanced tools, researchers are becoming better able to move beyond
the limitations of Koch’s postulates and to link infectious agents with chronic
diseases more precisely and with greater confidence than ever before. In addition,
researchers are developing sophisticated approaches for exploring the interplay
of genetic and environmental factors in the causation of a number of important
developmental behavioral disorders.
Participants also identified a number of general characteristics of a compre-
hensive and coordinated effort that would enhance efforts both to identify links
between infectious microorganisms and chronic diseases and to develop and
implement interventions to minimize their health consequences. For example,
they noted need to develop prototypes and standards to guide this work. Stan-
dardized case definitions are needed to facilitate research as well as the clinical
diagnosis of infection (active, persistent, or latent) and the chronic syndromes or
outcomes that result from it. Laboratory assays need to be adopted that are uni-
form in terms of sensitivity, specificity, and reproducibility. High-throughput as-
says meeting similar standards will be key to the study of large cohorts and popu-

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

8 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

lations. Without such tools, it will be difficult to interpret the significance of

clinical studies and to relate the results of one study to those of another.
Research coupled with appropriate public health activities will facilitate the
linkage of existing and newly designed databases, and ensure the quality surveil-
lance and epidemiologic studies needed to better characterize infectious and
chronic diseases by their population distribution and potential associations. Many
settings will demand expensive longitudinal investigations or the study of new,
prospective cohorts to complement case-control or cross-sectional investigations.
Additional observations can be made by conducting follow-up and look-back
studies using infectious disease and chronic disease surveillance systems and by
following outbreak cohorts or recently infected individuals. Longitudinal studies
may prove particularly valuable given that rapid advances in the field may dictate
that we might not know today which pieces of evidence will be needed in the
future. Detecting and confirming causal associations will require study of both
larger cohorts and better-defined at-risk populations.
A number of specific populations should receive particular attention, includ-
ing people who move from rural areas into cities, both in the developing and the
developed world. Studies are needed to see whether such movements redefine an
individual’s risk for a chronic outcome based on infections that they bring with
them or susceptibility to new infections that they previously had not encountered.
To provide effective clinical interventions, continued studies are needed to
define temporal relationships between infections and disease—that is, what stage
of infection determines outcome. Studies also are needed to clarify at which stage
infection must be prevented or treated in order to minimize or eliminate chronic
sequelae. It will be important to determine the expected benefit of actions, to
ensure that the benefits will outweigh any possible risks.
The improvement of both prevention and treatment for chronic diseases will
require a better understanding of their natural history, especially the earliest
stages. To generate such knowledge, clinicians should be encouraged to identify
patients who have recently developed or who seem to be developing a suspect
chronic disease, to systematically collect a range of clinical specimens, to follow
the course of the disease, and to identify telltale clinical features early.
Better animal models are also needed to explore and understand the potential
infectious causes of chronic illness. Diseases occurring in animals should be ex-
plored to better understand the potential paradigms of causal relationships. Ani-
mal models do not necessarily mimic human pathogenic processes, but examina-
tion of the similarities and differences between various models and human
diseases can be extremely informative. Additionally, more effort should be de-
voted to teaching health professionals about their value and their limitations. Psy-
chiatric modeling with animals may present an especially ripe area for probing a
variety of important questions, yet many practitioners in the field are not accus-
tomed to working with such models. Basic tools, such as species-specific immu-

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

SUMMARY AND ASSESSMENT 9

nologic reagents and diagnostics, must be developed to take advantage of this

potentially valuable approach. Similarly, the sensitivity and specificity of reagents
for human specimens must be verified when translating animal research to people.
Issues related to informed consent and human specimen collections and re-
positories take on new dimensions given these demands. The potential for devel-
oping new and improved diagnostic and analytical technologies that identify new
targets for chronic disease prevention strategies is very real. However, it is im-
possible to know how specimens collected today may be used in the future. There
is widespread concern that current regulations and guidelines are too complex,
too uncertain, or too restrictive for the meaningful sharing of data. Parties from
government, academia, and private funding agencies must collaborate to develop
a standard method of gaining patients’ consent, gathering identifying informa-
tion, and being able to use such information in the future. Current consent strate-
gies typically do not allow specimens and data to be used for unforeseen pur-
poses. Further complicating this issue are new state and federal laws regarding
the safeguarding and transfer of health-related information among professionals
and institutions, and stricter interpretation of long-standing regulations related to
informed consent.
The complexity of this field calls for an examination of whether the scientific
community is optimally organized to address these issues and whether its various
components communicate effectively. The community also should mount a con-
certed effort to identify gaps in current knowledge about the etiology of chronic
diseases, pinpoint what needs to be done to close those gaps, chart the obstacles
that stand in the way, and then identify and provide the necessary financial
resources (monetary and human) to drive progress. Cross-disciplinary and multi-
disciplinary approaches will be of critical importance, and the problems created
by specialization and programmatic stove-piping should be addressed explicitly.
Veterinary researchers, clinical researchers, basic scientists, and epidemiologists
need to work together as teams. An increasingly large share of future research
will likely involve either groups of investigators from a variety of disciplines or
groups of institutions working collaboratively. In many cases, these large projects
will include a multinational component to ensure that sufficient attention is paid
to multiracial, multiethnic, and multicultural differences.
There are many precedents for developing investigator collaborations, inter-
disciplinary consortia, and partnerships among academics and public health offi-
cials, but such endeavors are not necessarily easy and may not come naturally.
Both top-down and bottom-up strategies are appropriate for engaging the various
scientific disciplines required for this work. By setting appropriate guidelines,
funding agencies can play a major role in driving the formation of such interdis-
ciplinary research teams. Steps have been taken toward this end, but these prom-
ising efforts need to be nurtured to ensure continued cooperation.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

10 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

OPPORTUNITIES TO PREVENT AND MITIGATE THE IMPACT OF

CHRONIC DISEASES CAUSED BY INFECTIOUS AGENTS
Documentation of an association between a specific infectious agent and one
or more of the high-morbidity, high-mortality chronic diseases that consume most
health care resources in economically developed countries would have widespread
clinical and public health implications. The significance also would be felt in
developing countries, since chronic diseases already are consuming increasing
proportions of their available health-related resources—and the threat they face
from such diseases continues to grow apace. The benefits to be derived from
detecting and preventing causal infections, and from discontinuing interventions
against unproven causal agents, could be substantial. Workshop participants also
noted the potentially high impact of addressing less common chronic conditions
for which a preventable infection is the major cause.
Achieving these potential gains will hinge on several issues. Importantly, it
will be necessary to be able to identify causal links and their temporal relation-
ships while minimizing the risks of interventions against unproven etiologies.
With this scientifically sound information, new strategies can target the critical
point along the path from infection to chronic disease at which interventions might
avoid or mitigate illness and disability.
Linking one or more highly prevalent chronic conditions to infection with a
specific virus or bacteria might enable physicians to use vaccines and/or antibiot-
ics to prevent or cure the condition, thus eliminating the need for health workers
to rely on nonspecific therapies aimed at mitigating the symptoms of the condi-
tion. A classic example is immunization with hepatitis B vaccine. The introduc-
tion of this vaccine into universal childhood immunization programs has reduced
the incidence of hepatocellular carcinoma in some regions of the world where
this was previously one of the most common types of malignancy. There is a
strong possibility that the new sciences of genomics and proteomics will help to
detect the relevant antigens and to advance our understanding of both host immu-
nity to these pathogens and the process of disease pathogenesis. Such knowledge
will certainly open new strategies for therapy and prevention. Better approaches
to optimizing vaccine antigens also are being developed, and advances in the
field of vaccinology should promote such efforts.
Improved coordination among basic and clinical scientists, pathologists, and
epidemiologists will be critical to accomplishing these goals. Priorities for these
networks and collaborative teams are the development and application of:

• standardized case definitions (to be used in defining both infection and

disease outcomes);
• new and adequate specimen collections associated with pedigreed data-
bases;

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

SUMMARY AND ASSESSMENT 11

• appropriate epidemiologic design; and

• comparable methods of analysis that can be applied across a field of study.

The Forum discussions emphasized two major themes: (1) the need to define
the nature and scope of future research that will balance global efforts targeting
various chronic disease syndromes, and (2) the need to develop a coordinated and
systematic strategy to maximize resource use and overcome the inherent techno-
logic and epidemiologic challenges, as well as the organizational barriers, that
now impede progress in this field.

CONCLUSION
The substantial burden posed by chronic diseases of likely infectious etiol-
ogy demands global attention and action. Evidence continues to mount implicat-
ing microorganisms as important etiologic agents of chronic diseases that con-
tribute substantially to morbidity and mortality. However, the identification and
confirmation of infectious causes of chronic diseases is complicated by several
problems, including frequent multifactor causation for many of these diseases
and differences in the environmental background and genetic composition of dif-
ferent populations. Recently developed molecular and immunological techniques
offer new approaches to addressing the technical barriers. However, improved
coordination among basic and clinical scientists, pathologists, and epidemiolo-
gists also will be critical to progress. Standardization of case definitions and ana-
lytical assays combined with sound epidemiologic design will help, as will the
development of broad, new strategies for creating carefully pedigreed specimen
collections and disease registries. Although the task is daunting, taking the prac-
tical and pragmatic pathways described above could clarify many of the uncertain
relationships between infectious agents and chronic diseases.

Siobhán O’Connor, M.D., M.P.H. Stanley M. Lemon, M.D.

Assistant to the Director of the Vice-Chair, Forum on Microbial Threats
National Center for Infectious Dean, School of Medicine, University of
Diseases, Centers for Disease Texas Medical Branch
Control and Prevention
Clinical Assistant Professor,
Emory University School of Medicine

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

Defining the Relationship:

An Examination of Infectious Agents
Associated with Chronic Diseases

OVERVIEW
Chronic diseases cause 70 percent of all deaths in the United States. Yet the
factors that cause many of these conditions have been poorly understood until
recently. Advances in numerous detection and diagnostic techniques have re-
vealed that several chronic illnesses result from infectious agents. For example,
the human papillomavirus causes more than 90 percent of cervical cancers. The
hepatitis B virus accounts for more than 60 percent of liver cancer. The Epstein-
Barr virus produces in people simultaneously infected with malaria a cancer
known as Burkitt’s lymphoma, a leading cause of childhood cancer deaths glo-
bally. The bacterium Helicobacter pylori has been linked to a number of disor-
ders, including duodenal ulcers, gastric cancer, and certain types of lymphomas.
Other connections between infections and chronic diseases are suspected,
but not proven. Epstein-Barr virus, for example, has been found in patients with
Hodgkin’s disease and with aggressive breast cancers. Multiple sclerosis acts
suspiciously like an infection, with patients experiencing high antibody levels as
well as exacerbations and remissions. Juvenile-onset diabetes may arise when a
Coxsackie B enterovirus elicits an immune response that damages the pancreas.
Identifying and confirming an infectious cause of a chronic disease is com-
plicated by several factors:

• in some cases, microorganisms may act in a hit-and-run fashion, being

undetectable by the time the disease process becomes apparent (e.g., Reiter’s
syndrome, Guillian-Barré syndrome, rheumatic heart disease);
• infection may be in a persistent state at the time of diagnosis;

13

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

14 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

• acute, chronic, or recurrent infections may be involved in pathogenesis;

• detection and culture of microbes in a variety of tissues may be difficult;
• a number of factors, including environmental and genetic (host and mi-
crobe) factors, may be involved in the disease etiology; and
• adequate methods may be lacking to identify novel or rare microorgan-
isms.

The case studies presented in this chapter were chosen to provide insight into
the range of research under way in the field. The chronic diseases covered repre-
sent the full spectrum of those that have been linked in some degree, from “clearly
proven” to “suspected,” with infectious agents; they are caused by a variety of
microorganisms; and their association with disease is supported variously by labo-
ratory and epidemiological studies. Although other diseases and studies might
have been included, some limits were imposed by time constraints and the avail-
ability of speakers.
Eduardo Franco reviewed the evidence that human papillomavirus (HPV)
infection is a cause of cervical cancer. HPV infection precedes lesion develop-
ment and appears to be necessary for cervical cancer to occur. This is one of the
first examples in which an infectious agent has been identified to be necessary for
cancer development. This causal relationship was revealed through the use of
improved diagnostic tools that enabled more accurate identification of HPV. As
the role of infection by certain types of HPV is better elucidated as the cause of
cervical cancer, HPV testing in cervical cancer screening programs becomes an
important part of a primary prevention strategy. Another component of this strat-
egy may be increased use of a recently developed vaccine. Clinical studies indi-
cate that the new HPV 16 VLP vaccine was 100 percent effective in preventing
acquisition of persistent infection with HPV 16, and was 90 percent effective in
preventing any incident HPV 16 infection, transient or persistent. Immunization
against HPV may have greatest value in developing countries, where 80 percent
of the global burden of cervical cancer occurs each year.
William Mason presented the association between hepatitis B virus infection
and liver disease. Infection with the virus remains a worldwide problem, with
more than 350 million people chronically infected. Although a vaccine has been
available for the past 20 years, its high cost prevents universal vaccination. Cur-
rent research, therefore, has focused on the development of effective therapies to
cure those individuals chronically infected with the virus. Mason described the
research presently being conducted in a number of animal model systems, includ-
ing the woodchuck. Along with clinical studies, these models have been able to
characterize infections and evaluate therapies, as well as better elucidate the dif-
ficulties of treating chronic infections with nucleoside analogs.
Michael Dunne described the relationship between infection and cardio-
vascular disease. There is a tight association between hypercholesterolemia and
atherosclerosis; recent research has examined how inflammation within the plaque

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

DEFINING THE RELATIONSHIP 15

accumulated on arterial walls might drive atherosclerosis. Several pathophysi-

ologic hypotheses have been formulated:

1. Local infection might lead through a variety of pathways to arterial wall

atherogenic effects.
2. Local infection might produce a systemic inflammatory mediator that trav-
els to the atherosclerotic plaque and produces expression of adhesion molecules
along the endothelium, foam cell formation, and other proinflammatory reac-
tions.
3. Local infection might produce bacteremia or viremia from a variety of
pathogens that infect the arterial wall and induce those same inflammatory
changes.

There is a long list of potential causes: Chlamydia pneumoniae, cytomega-

lovirus, various dental disease organisms, H. pylori, and herpes simplex virus.
Anything leading to increased foam cell function in the plaque is a potential cul-
prit. This is an example where many different etiologic causes or multiple causes
might be involved in the same chronic condition either individually, synergisti-
cally, or multifactorially.
Richard Johnson reviewed the various ways that viral infections are associ-
ated with demyelinating diseases in animals and humans, including such direct
routes as oligodendrocytes or Schwann cells causing demyelination through cell
lysis or alteration of cell metabolism; virus-induced immune-mediated reactions,
such as incorporation of myelin antigens into the virus envelope or modification
of antigenicity of myelin membranes; and viral disruption of regulatory mecha-
nisms of the immune system. Human demyelinating diseases with known viral
etiology include postinfectious encephalomyelitis, acute disseminated encepha-
lomyelitis, and progressive multifocal leucoencephalopathy. A viral cause for
multiple sclerosis has been postulated for more than 100 years, and epidemio-
logic studies support this supposition and clearly show an environmental factor.
In addition, several studies show multiple sclerosis patients to have elevated lev-
els of various antiviral antibodies compared to controls.
Mark Pallansch discussed some of the difficulties in addressing the associa-
tion of chronic diseases with infectious diseases, using diabetes and enteroviruses
as examples. Type 1 diabetes is clearly a multifactorial disease: there is both a
clear genetic predisposition and an autoimmune component. The major manifes-
tation is the loss of beta cells in the pancreas and the associated loss of capacity to
produce insulin. There are more than 65 different enteroviruses, which include
the most common human viral infections. All individuals may have multiple in-
fections every year with at least one of these viruses. Because the standard en-
terovirus diagnostics are extremely labor-intensive, efforts are being made to de-
velop diagnostic tools based on reverse transcriptase-polymerase chain reaction
(RT-PCR). A semi-nested PCR method is available to determine presence or ab-

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

16 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

sence of enteroviruses, but ways of identifying specific enteroviruses remain to

be developed using this technology.
Robert Yolken and Fuller Torrey examined associations between infectious
agents and schizophrenia. Epidemiologic studies indicate that environmental
events during fetal development and early infancy may contribute to the risk of
schizophrenia in some individuals. Yolken and Torrey hypothesized that most
cases of schizophrenia are caused by infections and other environmental events
occurring in genetically susceptible individuals. The activation of endogenous
retroviruses within the central nervous system may possibly be one of several
mechanisms by which infections can lead to the disease. If this is the case, then
medications controlling these infections could play a major role in treating schizo-
phrenia.
Hung Fan examined evidence from an animal model supporting the possibil-
ity that an infectious agent may be involved in human lung adenocarcinoma.
Ovine pulmonary adenocarcinoma (OPA) is a contagious lung cancer of sheep.
Tumor samples from animals with OPA consistently contain exogenous jaag-
siekte sheep retrovirus (JSRV), which has an envelope gene with oncogenic po-
tential. JSRV-induced OPA is histologically very similar to human adenocarci-
noma. The lack of association of this cancer with tobacco smoking, together with
the disease’s increasing incidence, suggests the possibility of viral involvement.
David Persing discussed the pathogenesis of acne, a dermatologic inflamma-
tory disease unique to humans and the most common dermatological complaint
of adolescents and young adults. In addition to the role played by the bacteria
Propionibacterium acnes in the development of the inflammatory acne lesion,
Persing explained how P. acnes has been implicated as a source of heart valve
infections, postoperative implant infections, and prostheses failure. Recently P.
acnes has been implicated as a possible cause of chronic inflammation in sciatica.
Persing described his approaches to developing a vaccine for acne that could also
benefit other P. acnes-related chronic diseases.
Studies in each of these areas are advancing our understanding of the role
that infections play in chronic diseases. But the path from suspecting a microor-
ganism to proving its association with a specific disease can be long. The discov-
ery that H. pylori can cause duodenal ulcer disease is often cited as case in point
of both the hurdles and the rewards. The medical establishment in the United
States and worldwide remained skeptical of this link for years. Finally, the evi-
dence became overwhelming, and the discovery is credited with galvanizing re-
search for the entire field of infection and chronic disease. Medical treatment also
has evolved accordingly, with therapies shifting from surgery to blocking hypera-
cidity and, ultimately, to the use of antibiotics directed against H. pylori.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

DEFINING THE RELATIONSHIP 17

THE ROLE OF VIRUSES IN ONCOGENESIS: HUMAN

PAPILLOMAVIRUSES AND CERVICAL CANCER AS A PARADIGM
Eduardo L. Franco, M.P.H., Dr.P.H.*
Departments of Oncology and Epidemiology,
McGill University, Montreal, Canada

Like other malignant neoplasms of humans, cervical cancer is a disease with

multifactorial causes and long latency. Unlike most other cancers, however, in
which multiple environmental, biologic, and lifestyle determinants contribute in-
dependently or jointly to carcinogenesis, cervical cancer has been shown to have
a central causal agent, human papillomavirus (HPV) infection, whose contribu-
tion to the risk of the disease is much greater than that of any other recognized
determinant (IARC, 1995). Recently, there has been much attention to the fact
that it is virtually impossible to find cervical carcinoma specimens devoid of
traces of HPV DNA, which strongly suggests that HPV infection could be a nec-
essary cause for this malignancy (Franco et al., 1999a; Walboomers et al., 1999).
If this is really the case, then it would be a first in cancer research; no human
cancer has yet been shown to have a necessary cause, so clearly identified. Some
of the well-studied models in cancer causation, such as tobacco smoking in lung
cancer and chronic hepatitis B in liver carcinoma, are among the strongest epide-
miologic associations that one can find, but they do not represent causal relations
that are necessary. Lung cancers may occur in people who never smoked and had
only minimal exposure to environmental tobacco smoke, frequently as a result of
exposure to occupation-related carcinogens, and liver cancer may occur in indi-
viduals who never had hepatitis B, e.g., via aflatoxin exposure or hepatitis C.
The implications of this finding are substantial and have spawned new ap-
proaches to preventing cervical cancer on two fronts: (i) via screening for HPV
infection as the biological surrogate that reveals asymptomatic cervical cancer
precursor lesions and (ii) via primary immunization against HPV infection to
prevent the onset of such precursor lesions. While there is now intense research in
these two fronts the debate still continues concerning issues related to the etio-
logic mechanism whereby HPV infection initiates cervical carcinogenesis. This
brief overview addresses the epidemiologic characteristics of HPV infection and
cervical cancer and the recent progress using new approaches to preventing cervi-
cal cancer.

*The author’s research on the epidemiology of HPV infection and prevention of cervical cancer is

funded by grants from the Canadian Institutes of Health Research (CIHR) and from the U.S. National
Institutes of Health.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

18 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

Global Importance of Cervical Cancer

Cervical cancer is one of the most common malignant diseases of women. In
the US each year there are approximately 12,800 new cases of invasive cervical
cancer with 4,600 deaths due to this disease (Ries et al., 2000). On average during
the last decade, an estimated 371,000 new cases of invasive cervical carcinoma
were diagnosed annually worldwide, representing nearly 10 percent of all female
cancers. Its incidence is the third among women, after breast and colorectal can-
cer (Parkin et al., 1999). The highest risk areas are in Central and South America,
Southern and Eastern Africa, and the Caribbean, with average incidence rates
around 40 per 100,000 women per year. While risk in western Europe and North
America is considered relatively low at less than 10 new cases annually per
100,000 women, rates are 10 times higher in some parts of Northeastern Brazil,
where the cumulative lifetime risk can approach 10 percent (Muir et al., 1987).
Every year, an estimated 190,000 deaths from cervical cancer occur world-
wide, with over three-fourths of them in developing countries, where mortality
from this disease is the highest among deaths caused by neoplasms (Pisani et al.,
1999). Less than 50 percent of women affected by cervical cancer in developing
countries survive longer than five years whereas the 5-year survival rate in devel-
oped countries is about 66 percent (Pisani et al., 1999). Moreover, cervical cancer
generally affects multiparous women in the early post-menopausal years. In high-
fertility developing countries these women are the primary source of moral val-
ues and education for their children. The premature loss of these mothers has
important social consequences for the community.

Emergence of HPV Infection as the

Main Etiologic Factor in Cervical Cancer
Prominent among the risk factors for cervical cancer is the role of two mea-
sures of sexual activity, namely number of sexual partners and age at first inter-
course (Herrero, 1996), and also the sexual behavior of the woman’s male part-
ners (Brinton et al., 1989a). The consistency of the sexually-transmitted disease
model for cervical neoplasia led much of the laboratory and epidemiologic re-
search in attempting to identify the putative microbial agent or agents acting as
etiologic factor. Research conducted during the late 1960s and 1970s attempted
to unveil an etiologic role for the Herpes simplex viruses (HSV). Although HSV
was proven to be carcinogenic, in vitro and in vivo clinical studies eventually
demonstrated that only a fraction of cervical carcinomas contained traces (viral
DNA) of HSV infection and epidemiologic studies failed to demonstrate that the
association between HSV and cervical cancer was the primary causal element
(Franco, 1991).
In the 1980s, a solid research base emerged implicating HPV infection as the
sexually-transmitted cause of cervical cancer and its precursors. In 1995, the In-

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

DEFINING THE RELATIONSHIP 19

ternational Agency for Research on Cancer at the World Health Organization

(WHO), in its monograph series of carcinogenicity evaluation classified HPV
types 16 and 18 as carcinogenic to humans, HPV types 31 and 33 as probably
carcinogenic, and other HPV types (except 6 and 11) as possibly carcinogenic
(IARC, 1995). This classification was conservatively made on the basis of the
available published evidence until 1994. Subsequent research has permitted a
more inclusive grouping of genital HPV types on the basis of the presumed onco-
genic potential. HPV types 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, and 68
are considered to be of high oncogenic risk because of their frequent association
with cervical cancer and cervical intraepithelial neoplasia (CIN), the precursor,
pre-invasive lesion stage. The remaining genital types, e.g., HPV types 6, 11, 42–
44, and some rarer types are considered of low or no oncogenic risk (Bosch et al.,
1995). The latter types may cause subclinical and clinically visible benign lesions
known as flat and acuminate condylomata, respectively.
Today, it is well established that infection with high oncogenic risk HPV
types is the central causal factor in cervical cancer (IARC, 1995; Koutsky et al.,
1992; Nobbenhuis et al., 1999). Relative risks for the association between HPV
and cervical cancer are in the 20–70 range, which is among the strongest statisti-
cal relations ever identified in cancer epidemiology. Both retrospective and pro-
spective epidemiologic studies have demonstrated the unequivocally strong asso-
ciation between viral infection and risk of malignancy, both as CIN or invasive
disease (Bosch et al., 2002). Table 1-1 shows that HPV infection satisfies nearly
all of standard causal criteria in chronic disease epidemiology. However, not all
infections with high risk HPVs persist or progress to cervical cancer, thus sug-
gesting that, albeit necessary, HPV infection is not sufficient to induce this dis-
ease; other factors, environmental or host-related, are also involved. Among these
co-factors are: smoking (Ho et al., 1998a), high parity (Brinton et al., 1989b), use
of oral contraceptives (Moreno et al., 2002), diets deficient in vitamins A and C
(Potischman and Brinton, 1996), and genetic susceptibility traits, such as specific
HLA alleles and haplotypes (Maciag et al., 2000) and polymorphisms in the p53
gene (Makni et al., 2000). Understanding the role of these cofactors is the subject
of much ongoing research on the natural history of HPV infection and cervical
cancer (see Figure 1-1).

Human Papillomaviruses
HPVs are small, double-stranded DNA viruses of approximately 55 nanom-
eters (nm) with an icosahedral protein capsid containing 72 capsomers. The ge-
nome is circular and contains 7500–8000 base pairs (bp). HPVs have the follow-
ing characteristics:

• ~8 kilobase (kb) DNA virus from Papillomaviridae family

• Species- and tissue-specific

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

20 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

TABLE 1-1 Causality Criteria in HPV and Cervical Cancer

Degree of
Causal Criterion Evidence Findings
Strength of the association ++ Relative risks among the highest in cancer
epidemiology
Consistency ++ Association confirmed in multiple
epidemiologic studies
Temporality + Infection precedes lesion development
Biological gradient + Viral persistence and viral load affect disease
risk in dose-dependent manner
Coherence ++ Epidemiology does not conflict with molecular
pathogenesis data
Biological plausibility ++ Overwhelming body of evidence from
laboratory studies
Experimental evidence + HPV vaccination reduces short-term risk of
cervical cancer precursor lesions
Necessary factor? + HPV DNA found in virtually all cervical
cancers

Transient Co-factors : smoking, host

Sexual activity : (HLA, p53 polymorphism)
HPV
woman and her
infection
male partners
Viral
factors :
Persistent HPV variants
Co-factors
- : OC use, infection with and viral
parity, other STDs oncogenic types load

Normal Invasive
cervical Low grade High grade
cervical
epithelium lesions lesions
cancer

Co-factors : nutrition

FIGURE 1-1 Etiologic model in cervical carcinogenesis showing the primary role of
HPV infection, its relation with sexual activity, and the putative role of cofactors.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

DEFINING THE RELATIONSHIP 21

• Cannot be cultivated
• Over 150 genotypes identified, of which more than 40 infect the anogenital
tract
• High risk (oncogenic) types: 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59,
68
• Induces both benign (caused by low risk types) and malignant (caused by
high risk types) diseases
• Two major viral oncogenes: E6 (binds to p53) and E7 (binds to retino-
blastoma [Rb] protein)

Taxonomically, papillomaviruses used to be a subfamily in the Papovaviridae

family but are now grouped independently as a family, the Papillomaviridae. As
infectious agents, they are highly specific to their respective hosts. Different HPVs
are classified as types on the basis of DNA sequence homology in the E6, E7, and
L1 genes. More than 150 different HPV types have been catalogued so far (zur
Hausen, 2000).
The epithelial lining of the anogenital tract is the target for infection by over
40 different mucosotropic HPV types. Clinical, subclinical, and latent HPV in-
fections are the most common sexually-transmitted viral diseases today (Cox,
1995). Latent genital HPV infection can be detected in 5 to 40 percent of sexually
active women of reproductive age (IARC, 1995). In most cases, genital HPV
infection is transient or intermittent (Hildesheim et al., 1994; Ho et al., 1998b;
Moscicki et al., 1998; Franco et al., 1999b; Liaw et al., 2001); the prevalence is
highest among young women soon after the onset of sexual activity and falls
gradually with age, possibly as a reflection of accrued immunity and decrease in
sexual activity (meaning a decrease in number of sexual partners).
The carcinogenic mechanism following HPV infection involves the expres-
sion of two major viral oncogenes, E6 and E7, which produce proteins that inter-
fere with tumor suppressor genes controlling the cell cycle. Once viral DNA be-
comes integrated into the host’s genome, E6 and E7 become upregulated. While
E7 complexes with the cell growth regulator Rb protein, causing an uncontrolled
cell proliferation (Chellappan et al., 1992), the binding of E6 to p53 protein pro-
motes the degradation of the latter, thus exempting the deregulated cell to un-
dergo p53-mediated control (Thomas et al., 1996). The degradation of p53 by E6
leads to loss of DNA repair function and prevents the cell from undergoing
apoptosis. The infected cell can no longer stop further HPV-related damages and
becomes susceptible to additional mutations and genomic instability. Interest-
ingly, the effect of the E6 and E7 proteins on p53 and Rb has been shown to occur
only with high-risk HPVs but not with low-risk HPVs (Dyson et al., 1989).

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

22 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

Persistent HPV Infection as the

Precursor Event in Cervical Carcinogenesis
Most women who engage in sexual activity will probably acquire HPV in-
fection over a lifetime. As mentioned above, the vast majority of these infections
will be transient with only a small proportion becoming persistent. We have found
in our ongoing cohort study of Brazilian women that only 35 percent of the sub-
jects who were infected at enrollment retain their infections after 12 months, with
the mean duration being affected by the viral oncogenic potential (see Figure 1-
2). Infections with oncogenic HPVs tend to last longer on average (13.5 months)
than those with non-oncogenic types (8.2 months) (Franco et al., 1999b). A sub-
stantial increase in risk of CIN (see Figure 1-3) and cancer exists for women who
develop persistent, long-term infections with oncogenic HPV types (Koutsky et
al., 1992; Ho et al., 1998b; Nobbenhuis et al., 1999; Ylitalo et al., 2000; Moscicki
et al., 2001; Schlecht et al., 2001).
There is currently great interest in defining persistent infection and in obtain-
ing additional markers of pathogenesis for predictive purposes. Studies of viral
load and intratypic variation of HPVs indicate that persistent infections tend to

1.0

.8
Proportion remaining HPV positive

HPV 16/18
.6

Nononcogenic
.4 types

Oncogenic
types other than 16/18
.2

0.0
0 4 8 12 16 20 24
Time since enrollment (months)

FIGURE 1-2 Actuarial curves showing clearance of prevalent HPV infection according
to type present at enrollment in a cohort study of asymptomatic women presenting for
cervical cancer screening.
SOURCE: Adapted from Franco et al. (1999b).

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

DEFINING THE RELATIONSHIP 23

0.5

0.4
Cumulative incidence of any SIL

Persistent, oncogenic HPVs

0.3

Persistent, nononcogenic HPVs

0.2

Transient infection
0.1
HPV visits 1 and 2

0.0
0 12 24 36 48 60 72
Time since enrollment (months)

FIGURE 1-3 Actuarial curves showing the cumulative incidence of cervical squamous
intraepithelial lesions (SIL) according to HPV infection in the first two visits in a cohort
study of asymptomatic women presenting for cervical cancer screening.
SOURCE: Adapted from Schlecht et al. (2001).

yield higher viral loads than transient ones (Caballero et al., 1999) and those with
non-European variants of HPVs 16 and 18 tend to be associated with higher risk
of CIN as compared with those caused by European variants (Villa et al., 2000).
Defining viral persistence is critical because trials of HPV vaccine efficacy
rely on the reduction of the risk of persistent infection as one of the primary
outcomes. Similarly, concerning screening of cervical cancer by HPV testing, a
main drawback is the low positive predictive value of a single test because of the
relatively high prevalence of latent HPV infections in the population, particularly
among young women. The predictive value would increase substantially if test-
ing were to rely on repeated samplings, about 6 months apart, because of the
aforementioned high prognostic value of persistent positivity. However, popula-
tion screening cannot rely on repeated testing to be cost-effective and realistic as
a public health measure. It would be highly desirable if one could, with a single
HPV test, collect enough ancillary information on the virus and on the host that
would allow determining whether or not a single instance of HPV positivity is
likely to represent a persistent infection.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

24 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

HPV Testing in Cervical Cancer Screening

Detection of HPV DNA in cervical specimens using a commercially avail-
able assay has been shown to have greater sensitivity but somewhat lower speci-
ficity to detect CIN and cervical cancer as compared with the conventional Pap
cytology (Cuzick et al., 2000). This makes HPV testing a suitable alternative to
the latter in screening programs in middle- and high-income countries where cen-
tralized laboratory resources are available. The costs associated with an increased
number of women to be referred for colposcopy (because of the HPV test’s higher
false positive rate as compared to cytology) will likely be offset by the increased
screening interval that could later be recommended if HPV testing is eventually
used to replace cytology screening. The Pap test’s low sensitivity forces screen-
ing programs to recommend repeat tests frequently to ensure that lesions will not
be missed. In the US, fear of malpractice litigation has led to a conservative
recommendation of annual Pap smears by many professional groups. Combina-
tion testing of Pap cytology and HPV testing has the potential to allow extending
screening intervals (for women who are negative in both tests) to as long as 5
years, although this is yet to be proven a safe alternative in long-term follow-up
studies.

Primary Prevention by HPV Vaccination

Two main types of HPV vaccines are currently being developed: prophylac-
tic vaccines to prevent HPV infection and associated diseases, and therapeutic
vaccines to induce regression of precancerous lesions or remission of advanced
cervical cancer. DNA-free virus-like particles (VLP) synthesized by self-assem-
bly of fusion proteins of the major capsid antigen L1 induce a strong humoral
response with neutralizing antibodies. VLPs are thus the best candidate immuno-
gen for HPV vaccine trials. Protection seems to be type-specific so that produc-
tion of VLPs for a variety of high oncogenic risk types will be required. Such
vaccines are already under evaluation in safety and efficacy trials in different
populations and are sponsored by pharmaceutical companies and by the National
Institutes of Health (Schiller, 1999). The preliminary results of one such a trial
were extremely promising (Koutsky et al., 2002). It indicated that an HPV 16
VLP vaccine was 100 percent effective in preventing acquisition of persistent
infection with HPV 16 and 90 percent effective in preventing any incident HPV
16 infection, transient or persistent. As a noteworthy secondary finding was the
fact that all HPV 16-associated CIN cases occurred in the non-vaccinated group.
Immunization against HPV may have greatest value in developing countries,
where 80 percent of the global burden of cervical cancer occurs each year and
where Pap screening programs have been largely ineffective.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

DEFINING THE RELATIONSHIP 25

Conclusions
During the last 20 years, the concerted effort among virologists, epidemiolo-
gists, and clinical researchers has helped to elucidate the role of infection by
certain types of HPV as the necessary cause of cervical cancer. This has opened
new frontiers for preventing a disease that is responsible for substantial morbidity
and mortality, particularly among women living in resource-poor countries. Re-
search on two prevention fronts has already begun in several populations in the
form of preliminary trials assessing the efficacy of HPV vaccines and of studies
of the value of HPV testing in cervical cancer screening (see Figure 1-4). Progress
on both counts is very promising. While the benefits of vaccination against HPV
infection as a cervical cancer prevention tool are at least a decade into the future,
the potential benefits of HPV testing in screening for this disease can be realized
now in most populations.
Primary prevention of cervical cancer can also be achieved through preven-
tion and control of genital HPV infection. Health promotion strategies geared at a
change in sexual behavior targeting all sexually-transmitted infections of public
health significance can be effective in preventing genital HPV infection (Franco
et al., 2001). Although there is consensus that symptomatic HPV infection (geni-
tal warts) should be managed via treatment, counseling, and partner notification,
active case-finding of asymptomatic HPV infection is currently not recommended

Primary
screening Triage of
STD education, abnormalities and
HPV vaccination F/up of recurrences

Normal Persistent HPV + Invasive Metastatic Disability,

cervix HPV CIN cervical spread death
infection cancer

FIGURE 1-4 Opportunities for primary and secondary preventive approaches in the natu-
ral history of cervical cancer.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

as a control measure. Further research is needed to determine the effectiveness of

such a strategy and the significance of such infections concerning a woman’s
subsequent cancer risk.
Research on HPVs has progressed at a fast pace and has reached a volume of
nearly 1,000 annual publications in Medline. The HPV-cervical cancer model has
become a paradigm of progress in cancer research and among neoplastic diseases
with infectious roots. After 20 years, we have reached the point where preventing
cervical cancer via vaccination against HPV infection is in the foreseeable future.
It would be disastrous, however, if countries relaxed their cervical cancer screen-
ing programs in anticipation of a successful HPV vaccine. Existing cytology-
based screening programs that seem to work need to be constantly assessed for
quality and coverage. Ongoing research on the efficacy and cost-effectiveness of
HPV testing as a mass screening tool will help countries decide on the best ap-
proach for secondary prevention of cervical cancer and will probably lead to
reduced morbidity and mortality from this disease.

REFERENCES
Bosch FX, Manos MM, Muñoz N, Sherman M, Jansen AM, Peto J, Schiffman MH, Moreno V,
Kurman R, Shah KV. 1995. Prevalence of human papillomavirus in cervical cancer: a world-
wide perspective. International biological study on cervical cancer (IBSCC) Study Group. Jour-
nal of the National Cancer Institute 87:796–802.
Bosch FX, Lorincz A, Munoz N, Meijer CJ, Shah KV. 2002. The causal relation between human
papillomavirus and cervical cancer. Journal of Clinical Pathology 55:244–265.
Brinton LA, Reeves WC, Brenes MM, et al. 1989a. The male factor in the etiology of cervical cancer
among sexually monogamous women. International Journal of Cancer 44:199–203.
Brinton LA, Reeves WC, Brenes MM, Herrero R, de Britton RC, Gaitan E, Tenorio F, Garcia M,
Rawls WE. 1989b. Parity as a risk factor for cervical cancer. American Journal of Epidemiology
130:486–496.
Caballero OL, Trevisan A, Villa LL, Ferenczy A, Franco EL. 1999. High viral load is associated with
persistent HPV infection and risk of cervical dysplasia. 17th International Papillomavirus Con-
ference, Charleston, SC.
Chellappan S, Kraus VB, Kroger B, Munger K, Howley PM, Phelps WC, Nevins JR. 1992. Adenovi-
rus E1A, simian virus 40 tumor antigen, and human Papillomavirus E7 protein share the capac-
ity to disrupt the interaction between transcription factor E2F and the retinoblastoma gene prod-
uct. Proceedings of the National Academy of Sciences 89:4549–4553.
Cox JT. 1995. Epidemiology of cervical intraepithelial neoplasia: the role of human papillomavirus.
Baillière’s clinical obstetrics and gynaecology 9:1–37.
Cuzick J, Sasieni P, Davies P, Adams J, Normand C, Frater A, van Ballegooijen M, van den Akker-
van Marle E. 2000. A systematic review of the role of human papilloma virus (HPV) testing
within a cervical screening programme: summary and conclusions. British Journal of Cancer
83:561–565.
Dyson N, Howley PM, Munger K, Harlow ED. 1989. The human papilloma virus-16 E7 oncoprotein
is able to bind to the retinoblastoma gene product. Science 243:934–937.
Franco EL. 1991. Viral etiology of cervical cancer: a critique of the evidence. Reviews of Infectious
Diseases 13:1195–1206.
Franco EL, Rohan TE, Villa LL. 1999a. Epidemiologic evidence and human papillomavirus infection
as a necessary cause of cervical cancer. Journal of the National Cancer Institute 91:506–511.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

DEFINING THE RELATIONSHIP 27

Franco EL, Villa LL, Sobrinho JP, Prado JM, Rousseau MC, Desy M, Rohan TE. 1999b. Epidemiol-
ogy of acquisition and clearance of cervical human papillomavirus infection in women from a
high-risk area for cervical cancer. The Journal of Infectious Diseases 180:1415–1423.
Franco EL, Duarte-Franco E, Ferenczy A. 2001. Cervical cancer: epidemiology, prevention, and role
of human papillomavirus infection. Canadian Medical Association Journal 164:1017–1025.
Herrero R. 1996. Epidemiology of cervical cancer. Journal of the National Cancer Institute Mono-
graphs 21:1–6.
Hildesheim A, Schiffman MH, Gravitt PE, Glass AG, Greer CE, Zhang T, Scott DR, Rush BB,
Lawler P, Sherman ME, et al. 1994. Persistence of type-specific human papillomavirus infec-
tion among cytologically normal women. The Journal of Infectious Diseases 169:235–240.
Ho GY, Kadish AS, Burk RD, Basu J, Palan PR, Mikhail M, Romney SL. 1998a. HPV 16 and
cigarette smoking as risk factors for high-grade cervical intra-epithelial neoplasia. International
Journal of Cancer 78:281–285.
Ho GY, Bierman R, Beardsley L, Chang CJ, Burk RD. 1998b. Natural history of cervicovaginal
papillomavirus infection in young women. New England Journal of Medicine 338:423–428.
IARC Working Group. 1995. Human papillomaviruses. IARC Monographs on the evaluation of car-
cinogenic risks to humans. Vol. 64. Lyon: International Agency for Research on Cancer.
Koutsky LA, Holmes KK, Critchlow CW, Stevens CE, Paavonen J, Beckmann AM, DeRouen TA,
Galloway DA, Vernon D, Kiviat NB. 1992. A cohort study of the risk of cervical intraepithelial
neoplasia grade 2 or 3 in relation to papillomavirus infection. New England Journal of Medicine
327:1272–1278.
Koutsky LA, Ault KA, Wheeler CM, Brown DR, Barr E, Alvarez FB, Chiacchierini LM, Jansen KU.
2002. A controlled trial of a human papillomavirus type 16 vaccine. New England Journal of
Medicine 347:1645–1651.
Liaw KL, Hildesheim A, Burk RD, Gravitt P, Wacholder S, Manos MM, Scott DR, Sherman ME,
Kurman RJ, Glass AG, Anderson SM, Schiffman M. 2001. A prospective study of human
papillomavirus (HPV) type 16 DNA detection by polymerase chain reaction and its association
with acquisition and persistence of other HPV types. The Journal of Infectious Diseases 183:8–
15.
Maciag PC, Schlecht NF, Souza PS, Franco EL, Villa LL, Petzl-Erler ML. 2000. Major histocompat-
ibility complex class II polymorphisms and risk of cervical cancer and human papillomavirus
infection in Brazilian women. Cancer Epidemiology, Biomarkers and Prevention 9:1183–1191.
Makni H, Franco EL, Kaiano J, Villa LL, Labrecque S, Dudley R, Storey A, Matlashewski G. 2000.
p53 polymorphism in codon 72 and risk of human papillomavirus-induced cervical cancer: ef-
fect of inter-laboratory variation. International Journal of Cancer 87:528–533.
Moreno V, Bosch FX, Munoz N, Meijer CJ, Shah KV, Walboomers JM, Herrero R, Franceschi S.
2002. Effect of oral contraceptives on risk of cervical cancer in women with human
papillomavirus infection: the IARC multicentric case-control study. Lancet 359:1085–1092.
Moscicki AB, Shiboski S, Broering J, Powell K, Clayton L, Jay N, Darragh TM, Brescia R, Kanowitz
S, Miller SB, Stone J, Hanson E, Palefsky J. 1998. The natural history of human papillomavirus
infection as measured by repeated DNA testing in adolescent and young women. The Journal of
Pediatrics 132:277–284.
Moscicki AB, Hills N, Shiboski S, Powell K, Jay N, Hanson E, Miller S, Clayton L, Farhat S, Broering
J, Darragh T, Palefsky J. 2001. Risks for incident human papillomavirus infection and low-
grade squamous intraepithelial lesion development in young females. Journal of the American
Medical Association 285:2995–3002.
Muir C, Waterhouse J, Mack T, et al. 1987. Cancer incidence in five continents, Vol. V. IARC
Scientific Publications No. 88. Lyon: International Agency for Research on Cancer.
Nobbenhuis MA, Walboomers JM, Helmerhorst TJ, Rozendaal L, Remmink AJ, Risse EK, van der
Linden HC, Voorhorst FJ, Kenemans P, Meijer CJ. 1999. Relation of human papillomavirus
status to cervical lesions and consequences for cervical-cancer screening: a prospective study.
Lancet 354:20–25.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

28 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

Parkin DM, Pisani P, Ferlay J. 1999. Estimates of the worldwide incidence of 25 major cancers in
1990. International Journal of Cancer 80:827–841.
Pisani P, Parkin DM, Bray F, Ferlay J. 1999. Estimates of the worldwide mortality from 25 cancers in
1990. International Journal of Cancer 83:18–29.
Potischman N and Brinton LA. 1996. Nutrition and cervical neoplasia. Cancer Causes and Control
7:113–126.
Ries LAG, Eisner MP, Kosary CL, Hankey BF, Miller BA, Clegg L, Edwards BK, eds. 2000. SEER
Cancer Statistics Review: 1973-1997. Bethesda, MD: National Cancer Institute.
Schiller JT. 1999. Papillomavirus-like particle vaccines for cervical cancer. Molecular Medicine To-
day 5:209–215.
Schlecht NF, Kulaga S, Robitaille J, Ferreira S, Santos M, Miyamura RA, Duarte-Franco E, Rohan
TE, Ferenczy A, Villa LL, Franco EL. 2001. Persistent human papillomavirus infection as a
predictor of cervical intraepithelial neoplasia. Journal of the American Medical Association
286:3106–3114.
Thomas M, Matlashewski G, Pim D, Banks L. 1996. Induction of apoptosis by p53 is independent of
its oligomeric state and can be abolished by HPV-18 E6 through ubiquitin mediated degrada-
tion. Oncogene 13:265–273.
Villa LL, Sichero L, Rahal P, Caballero O, Ferenczy A, Rohan T, Franco EL. 2000. Molecular vari-
ants of human papillomavirus types 16 and 18 preferentially associated with cervical neoplasia.
The Journal of General Virology 81:2959–2968.
Walboomers JM, Jacobs MV, Manos MM, Bosch FX, Kummer JA, Shah KV, Snijders PJ, Peto J,
Meijer CJ, Munoz N. 1999. Human papillomavirus is a necessary cause of invasive cervical
cancer worldwide. The Journal of Pathology 189:12-9.
Ylitalo N, Josefsson A, Melbye M, Sorensen P, Frisch M, Andersen PK, Sparen P, Gustafsson M,
Magnusson P, Ponten J, Gyllensten U, Adami HO. 2000. A prospective study showing long-
term infection with human papillomavirus 16 before the development of cervical carcinoma in
situ. Cancer Research 60:6027–6032.
zur Hausen H. Papillomaviruses causing cancer: evasion from host-cell control in early events in
carcinogenesis. 2000. Journal of the National Cancer Institute 92:690–698.

CHRONIC HEPATITIS B VIRUS INFECTIONS

William Mason, Ph.D.
Fox Chase Cancer Center, Philadelphia, PA

Human hepatitis B virus (HBV) is a small, enveloped virus, with a partially

double-stranded, relaxed circular DNA genome of 3.3 kilobase pairs. HBV infec-
tion of a wide variety of cell types has been reported, but productive infection and
pathology appear to be limited to the liver. Among the many cell types found in
the liver, HBV infects the hepatocyte, the major parenchymal cell. Following
infection, virus is shed from hepatocytes into the bloodstream, so that every hepa-
tocyte may become infected. During the peak of an infection, titers of virus in the
blood may reach 1010 per cubic centimeter. Infection of hepatocytes is not typi-
cally cytopathic, and the liver pathology results from the immune response to the
infected cells. Depending on the strength of the immune response, infections may
be either transient or chronic. Transient infections generally resolve in fewer than
6 months, while chronic infections may be lifelong.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

DEFINING THE RELATIONSHIP 29

Hepatitis B Virus Replication

HBV replication in the liver occurs by reverse transcription (Seeger and
Mason, 2000; Summers and Mason, 1982). When a hepatocyte is infected, the
viral DNA genome is transported to the nucleus, where it is converted from a
relaxed circular DNA to a covalently closed circular form (cccDNA), which
serves as the template for viral mRNA synthesis. Though the coding capacity of
HBV is limited, it is still capable of encoding three envelope proteins, a nucleo-
capsid protein, a transcriptional transactivator, and a reverse transcriptase (RT).
Encoding of the reverse transcriptase, the largest HBV protein, requires almost
the entire viral genome. (To facilitate this, the reverse transcriptase is encoded in
different translational reading frames than the other viral gene products, so that
overlapping reading frames can be utilized.) mRNA for the RT is, in fact, slightly
greater than genome length, with a terminal redundancy of 220 base pairs (bp).
When this mRNA is translated, the RT binds near to the 5′ end of its own mes-
sage. This RNA/RT complex is then packaged into viral nucleocapsids, where the
RT transcribes the RNA into DNA, using one of its own tyrosine resides to prime
DNA synthesis (Weber et al., 1994; Zoulim and Seeger, 1994a). Following
completion of reverse transcription, the RT then synthesizes most, but not all of
the second DNA strand, to recreate the partially double stranded virion DNA.
Prior to completion of the second strand, nucleocapsids are packaged into viral
envelopes by budding into the endoplasmic reticulum, and virions are exported
from the cell. Since cccDNA lacks a replication origin, new cccDNA must be
created through the reverse transcription pathway (Tuttleman et al., 1986). Early
after infection, and probably after division of an infected hepatocyte, extra
cccDNA is synthesized, maintaining the copy number at 5 to 50 per cell. cccDNA
appears to be stable in non-dividing hepatocytes (Moraleda et al., 1997), but it is
unclear how efficiently cccDNA survives through mitosis.

Transmission
Transmission is parenteral, requiring exposure to the blood or blood-con-
taminated materials of infected individuals. The most common mode of exposure
leading to chronic infection occurs at birth when the mother is chronically in-
fected, or during the first year of life. During this period, the risk of an infection
becoming chronic is at least 90 percent. In contrast, the risk of chronic infection
in adults is greater than 10 percent. According to the CDC, the most common
exposure risks in adults in the United States are sexual activity (50 percent of
cases) and intravenous drug abuse (15 percent of cases).

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

30 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

Public Health Issues

Prevalence
The case fatality rate in adults due to acute hepatitis is about 1 percent. Indi-
viduals with chronic infection, typically acquired in childhood, have a ~25 per-
cent risk of premature death due to either liver cancer or cirrhosis, both resulting
from the persistent liver damage associated with infection. According to WHO,
there are now 350 million chronically infected individuals worldwide. Of these,
60 million are expected to die prematurely of liver cancer or cirrhosis, at a rate of
approximately 1 million per year (5,000 per year in the United States). This does
not account for new cases, which will continue to accumulate in the coming de-
cades.

Vaccines
A vaccine comprised of the viral envelope proteins has been available for
over 20 years. Due in part to high cost, universal vaccination was not initially
feasible in many parts of the world, but lower cost vaccines have subsequently
come into use. Universal vaccination of school children is now in effect in the
United States. In some parts of the world, especially in Africa and regions of
Asia, chronic infection rates exceed 5–10 percent of the population, but vaccina-
tion has not yet been economically feasible in all of these areas, even with low-
cost vaccines. Although attempts are under way to address this problem (Kane,
2003), for various reasons of cost and delivery, HBV is likely to remain a major
public health problem. On top of this problem there is evidence for vaccine es-
cape mutants (He et al., 2001; Torresi et al., 2002; Wilson et al., 2000). Though
these do not yet seem to be a major public health problem, they remain a concern
even for the large pool of individuals that have already received the current vaccine.
In addition, about 5 percent of vaccinated individuals fail to produce a measur-
able antibody response, suggesting that they also remain at risk for HBV infection.

Current Research
A major goal of current research has thus been the development of therapies
to cure chronically infected individuals. A problem in achieving this is that hepa-
tocytes comprise a self-renewing population with a low turnover rate, and this
population often appears to be 100 percent infected. This same barrier is con-
fronted and overcome during immune clearance of transient infections, though it
remains controversial how the virus is actually destroyed (Guidotti et al. 1999;
Guo et al., 2000; Jilbert et al., 1992; Kajino et al., 1994; Thimme et al., 2003).
However, in chronic carriers, the immune system is usually unable to mount such
a response, especially in those infected as children. Some hope for better immuno-

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

DEFINING THE RELATIONSHIP 31

therapies has however been sustained by the fact that interferon alpha administra-
tion induces virus loss in about 20–30 percent of carriers (Hoofnagle and Lau,
1997), typically those with adult-acquired infections. In addition, some carriers
experience spontaneous loss of the virus in association with a flare of liver dis-
ease. In both instances, clearance is probably due to activation of the same set of
immune responses that are active in clearance of transient infections. Key issues
now are how this clearance is carried out, whether it requires destruction of all of
the infected hepatocytes, if the immune system has the capacity to cure an infected
hepatocyte, and if it can be induced in carriers that have failed to respond to
interferon therapy with virus clearance.

Treatment
Another approach to treatment of chronic infections is administration of
nucleoside analog inhibitors of the HBV reverse transcriptase. Lamivudine was
approved by the U.S. Food and Drug Administration (FDA) in 1998 and has been
shown in clinical trials to have a treatment success rate similar to interferon alpha
(Perrillo, 2002). A significant problem with lamivudine is the emergence of drug-
resistant variants of HBV as therapy continues past a year. Another nucleoside,
adefovir dipivoxil, recently received FDA approval and to date drug-resistant
variants have not been reported. Moreover, this drug retains activity against
lamivudine-resistant HBV (Delaney et al., 2001). However, at doses higher than
used for HBV carriers, nephrotoxicity has been observed (Tanji et al., 2001). It
may be that nephrotoxicity will become a problem in HBV therapy due to a cu-
mulative effect if carriers require treatment indefinitely. A number of other
nucleoside analogs are now in Phase II trials. If these compounds are not toxic
during long-term administration, and if viral multi-drug resistance does not de-
velop, it should be possible to eliminate over time the viral cccDNA that main-
tains a cellular infection by a combination of dilution and hepatocyte death.
Achieving this would also allow a critical test of the hypothesis that curing a
chronic infection would significantly reduce the risk of death due to cirrhosis,
which seems likely, and due to liver cancer, which is difficult to predict, because
liver cancer may occur in a liver that appears relatively healthy histologically.

Research Models
HBV research generally reflects public health concerns. How can chronic
infections be cured? Will eliminating the virus reduce the risk of liver cancer and
premature death from liver disease? What is the mechanism of carcinogenesis?
(It is speculated that immune-mediated chronic injury, insertional mutagenesis,
and viral proteins all may play a role.) These questions have been investigated
using clinical samples and a number of model systems.
Woodchucks are naturally infected with woodchuck hepatitis virus (WHV)

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

32 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

(Summers et al., 1978), which is closely related to HBV and, like HBV, induces
liver cancer (but not cirrhosis) during a chronic infection (Popper et al., 1987).
Similarly, domestic ducks are infected with duck hepatitis B virus (DHBV), a
more distant relative of HBV (Mason et al., 1980; Zhou, 1980). Unlike HBV and
WHV, chronic DHBV infection has not been associated with either cirrhosis or
liver cancer, possibly because of a lower antiviral immune response in carriers.
HBV transgenic mice have been powerful tools for studying certain aspects of the
antiviral immune response (Guidotti and Chisari, 2001), even though these mice
do not support a complete HBV infection cycle (Tang and McLachlan, 2002). On
occasion, chimpanzees, which are susceptible to HBV, have been used to address
research issues (Guidotti et al., 1999; Thimme et al., 2003).
Among the model systems, the duck has been heavily used to understand the
virus life cycle at the molecular level, to study the biology of infection, and to
characterize antiviral therapies, primarily with nucleoside analogs. The wood-
chuck model has been less used to study molecular biology issues, but has been
employed extensively in the development of antiviral therapies and in character-
ization of the link between chronic infection and liver cancer. An unresolved
issue arose in the latter studies. It was found that liver cancer in woodchucks is
almost always associated with transcriptional activation of N-myc2 expression in
the liver by insertion of viral enhancer sequences (Fourel et al., 1994; Wei et al.,
1992). Contrary to expectation, insertional activation of N-myc2 does not appear
to be a correlate of liver cancer in HBV carriers. Indeed, with a few rare excep-
tions, it remains unclear if the frequent sporadic integration of viral DNA that
characterizes an infection has a role in most liver cancers that occur in individuals
chronically infected with HBV (Dejean et al., 1986; Gozuacik et al., 2001).
The HBV transgenic mouse, in contrast to the natural infection models, has
been most heavily used to demonstrate the effects of immune cytokines, such as
interferons alpha and gamma, on viral replication intermediates. It was found that
cytokines can induce the rapid clearance of viral proteins, RNAs, and DNAs from
mouse hepatocytes (Guidotti and Chisari, 2001). These observations seem likely
to provide part of the explanation for how virus replication is shut down during
the clearance of transient HBV infections.
Though the relationship to natural infections is still unclear, a number of
studies have shown that mice carrying the HBV transcriptional activator, X, as a
transgene, are at increased risk of developing liver cancer (Kim et al., 1991; Mad-
den et al., 2001; Terradillos et al., 1997). These data suggest that X is in fact a
viral oncogene, but clinical evidence to support this conclusion is still lacking,
and it is difficult to address this issue in the woodchuck model, because X is
needed to establish a productive infection (Chen et al., 1993; Zoulim and Seeger,
1994b).
In addition to characterizing infections and therapies, the animal models have
also provided, along with clinical studies, a better understanding of the difficul-
ties of treating chronic infections with nucleoside analogs. From such studies, it

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

DEFINING THE RELATIONSHIP 33

has been determined that cccDNA can persist in the liver for months, and prob-
ably years, even when virus DNA synthesis is effectively inhibited (Colonno et
al., 2001; Foster et al., 2003; Luscombe et al., 1996; Mason et al., 1994; Zhu et
al., 2001). Persistence of cccDNA may be attributable to two factors: 1) an inher-
ent stability within non-dividing hepatocytes, and 2) the relatively low turnover
(perhaps a few percent per day) of hepatocytes in most carriers. Studies with
animal models have also established that the mutation rate of the viruses is quite
high, with a single-base mutation prevalence of about 10-4 (Pult et al., 2001).
Thus, drug-resistant variants, especially those requiring only one or two base
changes, are likely to be present at the start of therapy. The primary factors needed
for subsequent emergence of drug-resistant variants are the time required for the
hepatocyte population to become susceptible to spread of virus (e.g., for loss of
super-infection resistance), the prevalence of a drug-resistant virus at the start of
therapy, and its growth rate (Zhang and Summers, 2000). In practice, emergence
of mutants can take from months to several years, the variation probably reflect-
ing additional factors, including the effect of nucleoside therapy on the antiviral
immune response of the host (Boni et al., 2001).

Outlook
Discovery of an effective HBV vaccine in the 1960s (Blumberg, 1977) led to
the hope that HBV would be eliminated, or at least substantially reduced in the
human population within the then foreseeable future. This still remains mostly a
hope. Two objectives still need to be fulfilled, universal vaccination (Kane, 2003),
and development of an effective therapy for chronic infection. Even though not
everyone will be protected using the current vaccine, most would be, and the
carrier incidence should decline substantially, first among the young. The goal of
complete elimination seems unlikely without major advances in the treatment
and elimination of chronic infections, particularly treatments that are rapid acting
and cost-effective.

REFERENCES
Blumberg BS. 1977. Australia antigen and the biology of hepatitis B. Science 197:17–25.
Boni C, Penna A, Ogg GS, Bertoletti A, Pilli M, Cavallo C, Cavalli A, Urbani S, Boehme R,
Panebianco R, Fiaccadori F, Ferrari C. 2001. Lamivudine treatment can overcome cytotoxic T-
cell hyporesponsiveness in chronic hepatitis B: new perspectives for immune therapy.
Hepatology 33:963–971.
Chen HS, Kaneko S, Girones R, Anderson RW, Hornbuckle WE, Tennant BC, Cote PJ, Gerin JL,
Purcell RH, Miller RH. 1993. The woodchuck hepatitis virus X gene is important for establish-
ment of virus infection in woodchucks. Journal of Virology 67:1218–1226.
Colonno RJ, Genovesi EV, Medina I, Lamb L, Durham SK, Huang ML, Corey L, Littlejohn M,
Locarnini S, Tennant BC, Rose B, Clark JM. 2001. Long-term entecavir treatment results in
sustained antiviral efficacy and prolonged life span in the woodchuck model of chronic hepatitis
infection. The Journal of Infectious Diseases 184:1236–1245.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

34 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

Dejean A, Bougueleret L, Grzeschik KH, Tiollais P. 1986. Hepatitis B virus DNA integration in a
sequence homologous to v-erb-A and steroid receptor genes in a hepatocellular carcinoma.
Nature 322:70–72.
Delaney WE, Edwards R, Colledge D, Shaw T, Torresi J, Miller TG, Isom HC, Bock CT, Manns MP,
Trautwein C, Locarnini S. 2001. Cross-resistance testing of antihepadnaviral compounds using
novel recombinant baculoviruses which encode drug-resistant strains of hepatitis B virus. Anti-
microbial Agents and Chemotherapy 45:1705–1713.
Foster WK, Miller DS, Marion PL, Colonno RJ, Kotlarski I, Jilbert AR. 2003. Entecavir therapy
combined with DNA vaccination for persistent duck hepatitis B virus infection. Antimicrobial
Agents and Chemotherapy 47:2624–2635.
Fourel G, Couturier J, Wei Y, Apiou F, Tiollais P, Buendia MA. 1994. Evidence for long-range
oncogene activation by hepadnavirus insertion. The European Molecular Biology Organization
Journal 13:2526–2534.
Gozuacik D, Murakami Y, Saigo K, Chami M, Mugnier C, Lagorce D, Okanoue T, Urashima T,
Brechot C, Paterlini-Brechot P. 2001. Identification of human cancer-related genes by naturally
occurring Hepatitis B Virus DNA tagging. Oncogene 20:6233–6240.
Guidotti LG and Chisari FV. 2001. Noncytolytic control of viral infections by the innate and adaptive
immune response. Annual Review of Immunology 19:65–91.
Guidotti LG, Rochford R, Chung J, Shapiro M, Purcell R, Chisari FV. 1999. Viral clearance without
destruction of infected cells during acute HBV infection. Science 284:825–829.
Guo JT, Zhou H, Liu C, Aldrich C, Saputelli J, Whitaker T, Barrasa MI, Mason WS, Seeger C. 2000.
Apoptosis and regeneration of hepatocytes during recovery from transient hepadnavirus infec-
tions. Journal of Virology 74:1495–1505.
He C, Nomura F, Itoga S, Isobe K, Nakai T. 2001. Prevalence of vaccine-induced escape mutants of
hepatitis B virus in the adult population in China: a prospective study in 176 restaurant employ-
ees. Journal of Gastroenterology and Hepatology 16:1373–1377.
Hoofnagle JH and Lau D. 1997. New therapies for chronic hepatitis B. Journal of Viral Hepatitis
4:41–50.
Jilbert AR, Wu TT, England JM, Hall PM, Carp NZ, O’Connell AP, Mason WS. 1992. Rapid resolu-
tion of duck hepatitis B virus infections occurs after massive hepatocellular involvement. Jour-
nal of Virology 66:1377–1388.
Kajino, K., A. R. Jilbert, J. Saputelli, C. E. Aldrich, J. Cullen, and W. S. Mason. 1994. Woodchuck
hepatitis virus infections: very rapid recovery after a prolonged viremia and infection of virtu-
ally every hepatocyte. Journal of Virology 68:5792–5803.
Kane MA. 2003. Global control of primary hepatocellular carcinoma with hepatitis B vaccine: The
contributions of research in Taiwan. Cancer Epidemiology, Biomarkers & Prevention 12:2–3.
Kim CM, Koike K, Saito I, Miyamura T, Jay G. 1991. HBx gene of hepatitis B virus induces liver
cancer in transgenic mice. Nature 351:317–320.
Luscombe C, Pedersen J, Uren E, Locarnini S. 1996. Long-term ganciclovir chemotherapy for con-
genital duck hepatitis B virus infection in vivo: Effect on intrahepatic-viral DNA, RNA, and
protein expression. Hepatology 24:766–773.
Madden CR, Finegold MJ, Slagle BL. 2001. Hepatitis B virus X protein acts as a tumor promoter in
development of diethylnitrosamine-induced preneoplastic lesions. Journal of Virology 75:3851–
3858.
Mason WS, Seal G, Summers J. 1980. Virus of Pekin ducks with structural and biological relatedness
to human hepatitis B virus. Journal of Virology 36:829–836.
Mason WS, Cullen J, Saputelli J, Wu TT, Liu C, London WT, E Lustbader, Schaffer P, O’Connell
AP, Fourel I, Aldrich CE, Jilbert AR. 1994. Characterization of the antiviral effects of 2′
carbodeoxyguanosine in ducks chronically infected with duck hepatitis B virus. Hepatology
19:398–411.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

DEFINING THE RELATIONSHIP 35

Moraleda G, Saputelli J, Aldrich CE, Averett D, Condreay L, Mason WS. 1997. Lack of effect of
antiviral therapy in nondividing hepatocyte cultures on the closed circular DNA of woodchuck
hepatitis virus. Journal of Virology 71:9392–9399.
Perrillo RP. 2002. How will we use the new antiviral agents for hepatitis B? Current Gastroenterol-
ogy Reports 4:63–71.
Popper H, Roth L, Purcell RH, Tennant BC, Gerin JL. 1987. Hepatocarcinogenicity of the woodchuck
hepatitis virus. Proceedings of the National Academy of Sciences 84:866–870.
Pult I, Abbott N, Zhang YY, Summers JW. 2001. Frequency of spontaneous mutations in an avian
hepadnavirus infection. Journal of Virology 75:9623–9632.
Seeger C and Mason WS. 2000. Hepatitis B virus biology. Microbiology and Molecular Biology
Reviews 54:51–68.
Summers J and Mason WS. 1982. Replication of the genome of a hepatitis B-like virus by reverse
transcription of an RNA intermediate. Cell 29:403–415.
Summers J, Smolec JM, Snyder R. 1978. A virus similar to human hepatitis B virus associated with
hepatitis and hepatoma in woodchucks. Proceedings of the National Academy of Sciences
75:4533–4537.
Tang H and McLachlan A. 2002. Avian and mammalian hepadnaviruses have distinct transcription
factor requirements for viral replication. Journal of Virology 76:7468–7472.
Tanji N, Tanji K, Kambham N, Markowitz GS, Bell A, D’Agati VD. 2001. Adefovir nephrotoxicity:
possible role of mitochondrial DNA depletion. Human Pathology 32:734–740.
Terradillos O, Billet O, Renard CA, Levy R, Molina T, Briand P, Buendia MA. 1997. The hepatitis B
virus X gene potentiates c-myc-induced liver oncogenesis in transgenic mice. Oncogene 14:395–
404.
Thimme R, Wieland S, Steiger C, Ghrayeb J, Reimann KA, Purcell RH, Chisari FV. 2003. CD8(+) T
cells mediate viral clearance and disease pathogenesis during acute hepatitis B virus infection.
Journal of Virology 77:68–76.
Torresi J, Earnest-Silveira L, Civitico G, Walters TE, Lewin SR, Fyfe J, Locarnini SA, Manns M,
Trautwein C, Bock TC. 2002. Restoration of replication phenotype of lamivudine-resistant hepa-
titis B virus mutants by compensatory changes in the “fingers” subdomain of the viral poly-
merase selected as a consequence of mutations in the overlapping S gene. Virology 299:88–99.
Tuttleman JS, Pourcel C, Summers J. 1986. Formation of the pool of covalently closed circular viral
DNA in hepadnavirus-infected cells. Cell 47:451–460.
Weber M, Bronsema V, Bartos H, Bosserhoff A, Bartenschlager R, Schaller H. 1994. Hepadnavirus
P protein utilizes a tyrosine residue in the TP domain to prime reverse transcription. Journal of
Virology 68:2994–2999.
Wei Y, Fourel G, Ponzetto A, Silvestro M, Tiollais P, Buendia MA. 1992. Hepadnavirus integration:
mechanisms of activation of the N-myc2 retrotransposon in woodchuck liver tumors. Journal of
Virology 66:5265–5276.
Wilson JN, Nokes DJ, Carman WF. 2000. Predictions of the emergence of vaccine-resistant hepatitis
B in The Gambia using a mathematical model. Epidemiology and Infection 124:295–307.
Zhang YY and Summers J. 2000. Low dynamic state of a viral competition in a chronic avian
hepadnavirus infection. Journal of Virology 74:5257–5265.
Zhou YZ. 1980. A virus possibly associated with hepatitis and hepatoma in ducks. Shanghai Medical
Journal 3:641–644.
Zhu Y, Yamamoto T, Cullen J, Saputelli J, Aldrich CE, Miller DS, Litwin S, Furman PA, Jilbert AR,
Mason WS. 2001. Kinetics of hepadnavirus loss from the liver during inhibition of viral DNA
synthesis. Journal of Virology 75:311–322.
Zoulim F and Seeger C. 1994a. Reverse transcription in hepatitis B viruses is primed by a tyrosine
residue of the polymerase. Journal of Virology 68:6–13.
Zoulim F and Seeger C. 1994b. Woodchuck hepatitis virus X protein is required for viral infection in
vivo. Journal of Virology 68:2026–2030.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

36 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

INFECTIOUS AGENTS AND CARDIOVASCULAR DISEASE

Michael Dunne, M.D.
Pfizer Global Research and Development, New London, CT

Atherosclerosis remains the most significant threat to the health of individu-

als living in the United States and Europe. Myocardial infarctions, strokes, pe-
ripheral vascular disease and premature deaths constitute an enormous burden on
the healthcare systems of these regions every year. Risk factors for atherosclero-
sis have been identified and interventions targeting these risks have helped miti-
gate its impact. The clinical sequelae of atherosclerosis remain significant, how-
ever, justifying continued research efforts to enhance the value of available
interventions as well as identify presently unappreciated risk factors.
Examination of an atherosclerotic plaque reveals pools of cholesterol under a
fibrous cap and the infiltration of monocytes and T cells at its margins. This
concentration of white blood cells within the plaque is consistent with an ongoing
inflammatory process, influenced by factors not yet fully understood. One such
influence may be infection.
That infection may play a role in atherosclerosis was first suggested over one
hundred years ago with the finding that acute infection with Bacillus typhosus
resulted in fatty sclerotic changes in the arterial wall (Gilbert and Lion, 1889;
Nieto, 1998). Interest in the role of infection in atherosclerosis was renewed with
the observation that patients with coronary artery disease were more likely than
matched controls to have an elevated antibody titer to Chlamydia pneumoniae
(Saikku et al., 1988). Since that observation, a number of additional associations
have been identified. The chain of events linking infections to the development of
atherosclerosis is outlined in Figure 1-5. A local infection may lead to an arterial
response through two different routes. First, local infection may trigger the sys-
temic release of various proinflammatory mediators, including cytokines, bacte-
rial lipopolysaccharide, heat shock proteins, immune complexes and, possibly,
activated, but uninfected, mononuclear cells. These mediators move through the
systemic circulation and incite an immune response in the arterial wall. This re-
sponse may include the upregulation of receptors on the endothelial cell surface,
enhancement of transendothelial migration of inflammatory cells, or activation of
white blood cells already existing within the plaque. These activated WBCs may
oxidize LDL cholesterol or release proteinases, which then act to destabilize the
overlying fibrous cap of the atheroma.
The second route by which infection may result in progression or initiation
of an atherosclerotic lesion involves the dissemination of organisms from local
sites of infection directly to the arterial wall itself. The organisms may traffic to
the site within an infected monocyte, attach and then diapedese through the en-
dothelial cell layer, taking advantage of secondary host defense mechanisms to

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

DEFINING THE RELATIONSHIP 37

Local infection

Bacteremia Systemic inflammatory mediators:

Cytokines
LPS

Infection of the
arterial wall

Arterial wall atherogenic effects:

Expression of adhesion molecules
Foam cell formation
Smooth muscle cell proliferation
Proinflammatory functions

FIGURE 1-5 Pathways through which local infection can lead to atherogenesis.

infect distal tissue. Once at the site, the organisms could drive a local inflamma-
tory process or, in addition, infect other cells within the arterial wall.
A number of potential pathogens have been associated with atherosclerosis
(Danesh, 1999). The strength of the association varies with the organism but is
based on seroepidemiologic studies, histopathologic evidence of disease, animal
model data and various pathophysiologic associations. Among possible viral
pathogens are cytomegalovirus and herpes simplex (Nieto, 1999; Dunne, 2000).
Among bacterial pathogens are various dental organisms, Helicobacter pylori,
and Mycoplasma pneumoniae. The most significant amount of preclinical and
clinical investigation, however, has focused on C. pneumoniae; as an example of
the types of evidence that can implicate a potential infectious pathogen driving
some component of the atherosclerotic process, these data will be reviewed in
more detail.

C. Pneumoniae and Atherosclerosis Seroepidemiologic Studies

Since the initial study that identified an association between elevated C.
pneumoniae antibody titers and the prevalence of coronary artery disease, over
thirty additional studies have been performed and multiple review articles pub-
lished. These studies used different antibody detection assays with different titer

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

38 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

cutoffs, different case definitions of coronary artery disease, and were performed
in different geographic regions. Overall, it appears that elevated antibody titers to
C. pneumoniae are associated with a three-fold increase in the likelihood of hav-
ing coronary artery disease. The association identified in seroepidemiologic stud-
ies using titers to predict the incidence, distinct from the prevalence, of heart
disease, however, only variably detect an association and, when positive, only in
the range of a 20–40 percent increased risk (Dunne, 2000). While the implica-
tions of these different findings are being evaluated, the main value of these
seroepidemiologic studies may be the attention they have brought to the potential
for any association at all.

Histopathology
The next series of studies involve histopathologic examinations of the athero-
matous plaque. In the first 15 studies reported in the literature which were con-
ducted in the United States and Europe, approximately 45 percent of the total of
574 samples examined were found to contain evidence of C. pneumoniae by ei-
ther immunohistochemistry, electron microscopy, in situ polymerase chain reac-
tion (PCR) or, rarely, culture. The primary criticism of these studies has focused
on the lack of standardization of the assay techniques but, given the bulk of the
observations from these and subsequent studies, it seems likely that this pathogen
can be found in the plaque.
Because antibody titers merely suggest historical exposure to the pathogen,
there has been recent interest in the use of PCR to identify individuals that may
have an active infection with C. pneumoniae. PCR has been used to assess both
histopathologic specimens and circulating white blood cells. In four published
papers, patients with a history of coronary artery disease were more likely than
controls to have C. pneumoniae identified in circulating monocytes by PCR
(Dunne, 2000). In a fifth paper, the incidence was not significantly different but
the C. pneumoniae rRNA copy number was higher in patients with heart disease
(Berger et al., 2000). Of interest, the proportion of individuals with PCR positive
cells in these studies ranged from 9 to 60 percent in the patients with heart disease
and 2 to 46 percent in the controls. While this range of exposure may be ex-
plained by epidemiologic influences, technical concerns about assay methodolo-
gies remain and efforts at standardization have been initiated (Dowell et al., 2001).
When the technical concerns have been addressed, it will also be important to
understand why otherwise normal individuals have evidence of this pathogen
circulating in what should be a sterile space.

Animal Models
In addition to serologic and histologic evidence associating C. pneumoniae
and atherosclerosis, a number of animal models have been established. Evidence

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

DEFINING THE RELATIONSHIP 39

that C. pneumoniae can either initiate or accelerate the atherosclerotic lesion has
come from work with both mice (NIH/s, ApoE-deficient, and LDL-receptor
knock-out strains) and New Zealand White rabbits. These animals generally need
to consume a high cholesterol diet in order to develop observable changes, though
it is possible, in one of the rabbit models, to observe effects without an athero-
genic diet (Fong et al., 1999). In the LDL receptor knockout mouse, intranasal
inoculation with the C. pneumoniae AR39 strain twice monthly for six months
was performed prior to sacrifice of the animals. Uninfected mice fed a high cho-
lesterol diet had a lesion area index (defined as the size of a digitized image of the
lesion divided by the aorta luminal surface and multiplied by one hundred) of 18,
while infected animals given a high cholesterol diet had an index of 42. This 130
percent increase in lesion size suggests that infection with chlamydia can acceler-
ate the growth of an atherosclerotic plaque (Hu et al., 1999).
There are limitations to the interpretation of animal models of atherosclero-
sis. In some of these models the atherosclerotic lesions observed are consistent
with a very early pathologic process that does not mirror the lesions responsible
for causing human disease. The atherosclerotic lesions in these models generally
do not rupture or lead to clinical disease in the animal. While these data do sup-
port the potential for a contribution of chlamydia to lipid accumulation at the site,
they do not provide conclusive evidence that infection will lead to plaque rupture.

Chlamydia Pathogenesis and Atherogenesis

A fourth line of persuasive evidence comes from similarities in the patho-
physiology of C. pneumoniae infection and atherogenesis. The generation of an
atherosclerotic plaque is generally felt to be a chronic process. To the extent that
a chlamydia infection, in addition to any acute effects, has a chronic component
to its pathophysiology, an association with atherosclerosis can be more easily
defended. The demonstration that chlamydia may exist in a persistent state may
serve to explain the latent nature of a chlamydia infection.
Chlamydia exists as elementary bodies in the environment. Upon entry into a
host cell the elementary body undergoes a series of transformations that allow it
ultimately to replicate. At this stage it is referred to as a reticulate body. After cell
division, it again reverts to an elementary body and is released from the host cell.
If, however, host cell conditions are not favorable, chlamydia will not progress
through cell division and instead moves into what has been referred to as a persis-
tent state, appearing morphologically as a large, aberrant form (Beatty et al.,
1994). The organism has been found to persist in cell culture in this state for
prolonged periods of time and, in vitro, to be relatively refractory to antibiotic
therapy.
While evidence for a persistent state has not been established in clinical speci-
mens, it remains possible that chlamydia could contribute to a chronic condition
by remaining relatively dormant, while still influencing the condition of the host

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

40 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

cell. A series of experiments (Zhong et al., 1999; 2000), has offered some in-
sights as to why a chronically infected host cell is not destroyed by the immune
system. It appears that chlamydia can selectively inhibit IFN-gamma-inducible
MHC class I and II expression and thereby evade antigen presentation on the cell
surface. Inhibition of this process by bacterial protein synthesis inhibitors such as
chloramphenicol suggests that it is dependent on chlamydial protein synthesis.
Clinically latent infections have been demonstrated with a number of chlamy-
dia species. The blinding eye disease trachoma has occurred decades after expo-
sure to either C. trachomatis or C. pneumoniae. Infertility can result from chronic
infection of the upper genital tract with C. trachomatis, a process that can take
place over years. C. pneumoniae has also been isolated from the respiratory tract
long after resolution of an acute infection.
Atherosclerosis is now considered to be an inflammatory disease (Ross,
1999). The association of C. pneumoniae with atherogenesis is supported by the
possibility that C. pneumoniae contributes to this inflammation. Based on data
from animal models, and supported by the PCR examinations of circulating white
blood cells and histologic examinations of atherosclerotic tissue, a respiratory
tract infection could lead to dissemination of C. pneumoniae in monocytes. These
monocytes release factors that enhance the likelihood of endothelial infection
with chlamydia (Lin et al., 2000). Once infected, the endothelial cells could affect
the local arterial environment in three ways. Transendothelial migration of the
monocytes is enhanced (Molestina et al., 1999). The infected endothelial cells
release tissue factor and platelet aggregation inhibitor, which leads to enhanced
coagulability at the site. And thirdly, mitogenic factors are released through an
NF-Kβ related mechanism, leading to smooth muscle cell proliferation (Miller et
al., 2000). This triad, subendothelial monocyte accumulation, hypercoagulability
at the site of the atheroma and smooth muscle cell proliferation, is the hallmark of
an atherosclerotic plaque and, as such, provides further support for a contribution
of local C. pneumoniae infection to this inflammatory state.

Clinical Trials with Antibiotics

Even with continued gaps in our understanding of the association between
infection and atherosclerosis, the significance of coronary artery disease as an
unmet medical need has driven interest in conducting antibiotic intervention stud-
ies. Based on the various supportive data discussed thus far, a number of clinical
trials designed to investigate the role of antibiotic intervention in reducing the
incidence of atherosclerotic disease have been initiated. There is certainly more
work that needs to be done preclinically, including additional studies outlining
the role of C. pneumoniae in atherogenesis, improving the capabilities around
diagnostic testing, understanding the influence of antibiotics, alone or in combi-
nation, on chlamydia replication, further exploring animal models of in vivo

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

DEFINING THE RELATIONSHIP 41

pathogenesis, and better defining the lifecycle of chlamydia, and specifically the
persistent state.
There are a number of challenges to studying the use of antibiotics in clinical
coronary artery disease. While several risk factors for coronary artery disease are
already well established, the relationship between these risk factors and C.
pneumoniae infection has not been fully examined. As such associations become
better known, the use of these risk factors as selection criteria may become use-
ful. Clinical studies will need to address this problem of multiple competing risks
even while the appropriateness of controlling for these factors in any statistical
analyses, or selecting the target group of patients to treat, remains open to debate.
Many questions remain regarding antimicrobial activity within the plaque.
While there is clinical evidence that patients with either genitourinary tract or
respiratory tract infections due to chlamydia can have the clinical course of their
disease positively impacted by antibiotic intervention, it remains unknown
whether antibiotic treatment will affect either the replication or pathogenicity of
chlamydia infections in the atherosclerotic plaque. It may not be possible to either
document infection at the arterial site or substantiate a positive microbiologic
outcome. There remain concerns that to the extent that cells contain chlamydia in
the persistent state, it may not be possible to fully eradicate the organism. Stan-
dard in vitro testing may be inadequate to fully address this issue, given that the
contribution of the immune system to clearance of infected cells is not measured.
Specific concerns about the design of clinical trials also exist. The appropri-
ate patient population to treat is not clear. If C. pneumoniae is the target organ-
ism, patient selection criteria specific to the organism could be useful. Antibody
titers are a crude estimate of previous exposure but may not be adequate to select
those patients actively infected. As identification of infection within the atheroma
is not presently possible, surrogates of active infection are needed. Perhaps, in the
future, there will be a role for the measurement of C. pneumoniae DNA in circu-
lating white blood cells. As is typical with cardiovascular studies of coronary
artery disease, the event rates are typically low. Selection of patients likely to
have a primary event is critical to ensuring that any treatment effect can be ob-
served. Setting the sample size is made difficult by not having any estimate of the
potential treatment effects; in order to avoid missing a potential effect, efficacy
rates may need to be assumed to be low. These two issues require that definitive
studies be large in order to have sufficient statistical power to determine treat-
ment effects. Interpretation of the results from smaller studies is consequently
more problematic.
The results of ongoing clinical trials will be best able to answer questions
that are focused on the merits of the antibiotic intervention in the specific popula-
tion of patients enrolled, and focused on the prespecified endpoints. The results
will be compelling to the extent that the studies are adequately powered and the
chosen endpoints are clinically relevant. The ongoing trials are less likely to be
able to define the mechanism of action underlying any observed treatment effect.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

42 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

Pre- and post-treatment measurement of such inflammatory indices as C-reactive

protein, cytokines, fibrinogen and tissue factor could be performed, but determin-
ing whether any changes are a direct result of immune specific activity or an
indirect result of reducing the burden of organisms may be problematic.
A number of antibiotic intervention studies have been initiated. The antibiot-
ics used have been either macrolides, doxycycline or a fluoroquinolone, given the
in vitro activity of classes of drugs against C. pneumoniae. Of the completed
studies, the two earliest reported promising results, both with short-term thera-
pies, but the small sample size of these trials precludes any definitive conclusions
(see Table 1-2). In general, the trial design has varied such that no two are the
same. They have focused on primary or secondary prevention, different antibiotic

TABLE 1-2 Clinical Trials with Antibiotics for Primary and Secondary
Prevention of Atherosclerosis Diseases
Study Population N Antibiotic Endpoint Outcome

St. George’s Post-MI 80 Azithromycin Heart Event rate:

(Gupta et al., Diseasea 8% vs. 28%
1997)

ROXIS CAD 200 Roxithromycin Heart Event rate:

(Gurfinkel et al., Diseasea 1% vs. 10%
1997)

CROAATS Post-MI 234 Azithromycin Heart Event rate:

(Reiner, 2002) Diseasea 7.0% vs. 5.2%

ACADEMIC CAD 300 Azithromycin Heart Hazard ratio:

(Anderson et al., Diseasea 0.89 (0.51, 1.61)
1999)

ANTIBIO Acute MI 892 Roxithromycin Heart Event rate:

(Zahn et al., 2003) Diseasea 25% vs. 21%

ISAR-3 Angioplasty 1010 Roxithromycin Restenosis Hazard ratio:

(Neumann et al., 1.08 (0.92, 1.26)
2001)

Macrolide for PAD Peripheral 40 Roxithromycin Interventions Event rate:

(Wiesli et al., 2002) artery disease for 20% vs. 45%
claudication
aSome combination of either recurrent MI, hospitalization for angina, coronary artery intervention,

stroke, or death.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

DEFINING THE RELATIONSHIP 43

interventions, different durations of therapy, different cardiovascular endpoints

and different manifestations of atherosclerosis at baseline. This variability in study
design is a consequence of many of the issues noted above and is to be expected
at this early stage of the development of a potential new intervention strategy.
Results of future study designs that incorporate data-driven refinements in patient
selection, duration of dosing and choice of antibiotic will be required before a
complete assessment of the value of antibiotic intervention can be made.
Conclusion
Atherosclerosis is an inflammatory disease. That infection may serve as a
root cause of this inflammation is supported by a number of different lines of
evidence. At present, the most compelling data support the role of C. pneumoniae
through pathogens, such as cytomegalovirus and dental organisms, should not be
discounted. The macrophage is a critical component in the pathway to atheroscle-
rotic inflammation. To the extent that an infectious process activates a macro-
phage, either in the local arterial milieu or at a distant site, there is the potential
for that macrophage to stimulate both local lipid accumulation and the instability
that presages plaque rupture. Given the burden that coronary artery disease
imparts on the healthcare system and on society in general, efforts to both under-
stand the role of infection in atherogenesis, and to develop targeted intervention
strategies, should continue apace.

REFERENCES
Anderson JL, Muhlestein JB, Carlquist J, Allen A, Trehan S, Nielson C, Hall S, Brady J, Egger M,
Horne B, Lim T. 1999. Randomized secondary prevention trial of azithromycin in patients with
coronary artery disease and serological evidence for Chlamydia pneumoniae infection: the
azithromycin in coronary artery disease: elimination of myocardial infection with chlamydia
(ACADEMIC) study. Circulation 99:1540–1547.
Beatty WL, Morrison RP, Byrne GI. 1994. Persistent chlamydiae: from cell culture to a paradigm for
chlamydial pathogenesis. Microbiological Reviews 58:686–699.
Berger M, Schroder B, Daeschlin G, Schneider W, Busjahn A, Buchalow I, Luft FC, Haller H. 2000.
Chlamydia pneumoniae DNA in non-coronary atherosclerotic plaques and circulating
leokocytes. Journal of Laboratory and Clinical Medicine 136:194–200.
Danesh J. 1999. Coronary heart disease, Helicobacter pylori, dental disease, Chlamydia pneumoniae,
and cytomegalovirus: meta-analyses of prospective studies. American Heart Journal 138:S434–
437.
Dowell SF, Peeling RW, Boman J, Carlone GM, Fields BS, Guarner J, Hammerschlag MR, Jackson
LA, Kuo CC, Maass M, Messmer TO, Talkington DF, Tondella ML, Zaki SR. 2001. Standard-
izing Chlamydia pneumoniae assays: recommendations from the Centers for Disease Control
and Prevention (USA) and the Laboratory Centre for Disease Control (Canada). Clinical Infec-
tious Diseases 33:492–503.
Dunne M. 2000. The evolving relationship between Chlamydia pneumoniae and atherosclerosis. Cur-
rent Opinion in Infectious Diseases 13(6):583–591.
Fong IG, Chiu B, Viira E, Jang D, Fong MW, Peeling R, Mahony JA. 1999. Can an Antibiotic
(macrolide) prevent Chlamydia pneumoniae-induced atherosclerosis in a rabbit model? Clinical
and Diagnostic Laboratory Immunology 6:891–894.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

44 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

Gilbert A and Lion G. 1889. Artérites infectieuses expérimentales. Comptes Rendus Hebdomadaires
des Séances et Mémoires de la Société de Biologie. 41:583–584.
Gupta S, Leatham EW, Carrington D, Mendall MA, Kaski JC, Camm AJ. 1997. Elevated Chlamydia
pneumoniae antibodies, cardiovascular events, and azithromycin in male survivors of myocar-
dial infarction. Circulation 96:404–407.
Gurfinkel EG, Bozovich G, Daroca A, Beck E, Mautner B. 1997. Randomised trial of roxithromycin
in non-Q-wave coronary syndromes: ROXIS Pilot Study. ROXIS Study Group. [comment].
Lancet 350:404–407.
Hu H, Pierce GN, Zhong G. 1999. The atherogenic effects of chlamydia are dependent on serum
cholesterol and specific to Chlamydia pneumoniae. Journal of Clinical Investigation 103:747–
753.
Lin TM, Campbell LA, Rosenfeld ME, Kuo CC. 2000. Monocyte-endothelial cell coculture enhances
infection of endothelial cells with Chlamydia pneumoniae. Journal of Infectious Diseases
181:1096–1100.
Miller SA, Selzman CH, Shames BD, Barton HA, Johnson SM, Harken AH. 2000. Chlamydia
pneumoniae activates nuclear factor kappaB and activator protein 1 in human vascular smooth
muscle and induces cellular proliferation. Journal of Surgical Research 90:76–81.
Molestina RE, Miller RD, Ramirez, JA Summersgill JT. 1999. Infection of human endothelial cells
with Chlamydia pneumoniae stimulates transendothelial migration of neutrophils and mono-
cytes. Infection & Immunity 67:1323–1330.
Neumann FA, Kastrati A, Miethke T, Pogatsa-Murray G, Mehilli J, Valina C, Jogethaei N, da Costa
CP, Wagner H. Schomig A. 2001. Treatment of Chlamydia pneumoniae infection with
roxithromycin and effect on neointima proliferation after coronary stent placement (ISAR-3): a
randomised, double-blind, placebo-controlled trial. Lancet 357:2085–2089.
Nieto FJ. 1998. Infections and atherosclerosis: new clues from and old hypothesis? American Journal
of Epidemiology 48:937–948.
Nieto FJ. 1999. Viruses and atherosclerosis: a critical review of the epidemiologic evidence. Ameri-
can Heart Journal 138:S453–460.
Reiner Z. 2002. Azithromycin in the secondary prevention of adverse cardiovascular events in C.
pneumoniae-positive post myocardial infarction patients (CROAATS). Paper presented at the
Sixth International Conference on the Macrolides, Azalides, Streptogramins, Ketolides, and
Oxazolidinones, Bologna, Italy, January 23-25, 2002.
Ross R. 1999. Atherosclerosis—an inflammatory disease. [comment]. New England Journal of Medi-
cine 340:115–126.
Saikku P, Leinonen M, Mattila K, Ekman MR, Nieminen MS, Makela PH, Huttunen JK, Valtonen V.
1988. Serological evidence of an association of a novel Chlamydia, TWAR, with chronic coro-
nary heart disease and acute myocardial infarction. Lancet 2:983–986.
Wiesli P, Czerwenka W, Meniconi A, Maly F, Hoffman U, Vetter W, Schulthess G. 2002.
Roxithromycin treatment prevents progression of peripheral arterial occlusive disease in
Chlamydia pneumoniae seropositive men: a randomized, double-blind, placebo-controlled trial.
Circulation 105:2646–2652.
Zahn R, Schneider S, Frilling B, Seidl K, Tebbe U, Weber M, Gottwik M, Altmann E, Seidel F, Rox
J, Hoffler U, Neuhaus KL, Senges J. Working Group of Leading Hospital Cardiologists. 2003.
Antibiotic therapy after acute myocardial infarction: a prospective randomized study. Circula-
tion 107:1253–1259.
Zhong G, Fan T, Lui L. 1999. Chlamydia inhibits interferon gamma-inducible major histocompatibil-
ity complex class II expression by degradation of upstream stimulatory factor 1. Journal of
Experimental Medicine 189:1931–1938.
Zhong G, Liu L, Fan T, Fan P, Ji H. 2000. Degradation of transcription factor RFX5 during the
inhibition of both constitutive and interferon gamma-inducible major histocompatibility com-
plex class I expression in chlamydia-infected cells. Journal of Experimental Medicine 191:1525–
1534.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

DEFINING THE RELATIONSHIP 45

DEMYELINATING DISEASES
Richard T. Johnson, M.D.
Johns Hopkins University, Baltimore, MD

Viral infections cause a variety of demyelinating diseases in animals and

humans. Demyelinating diseases are defined as disorders of the central or periph-
eral nervous system with destruction of myelin and relative preservation of axons.
Other histopathological features do not alter the definition; oligodendrocytes or
Schwann cells may or may not be affected, astrocytosis and gliosis may or may
not be prominent, and inflammation may or may not be present. All of these
features have been described in virus-induced demyelinating disorders. The patho-
genesis of the demyelination is different with different infections; these mecha-
nisms range from direct infection and lysis of oligodendrocytes to immune de-
struction of myelin or supporting cells by cell-mediated immune responses,
antibody, or cytokines (see Box 1-1). Many studies of virus-induced demyelinat-

Box 1-1
Possible Mechanisms of Virus-Induced Demyelination

1. Direct viral effects

• Virus infection of oligodendrocytes or Schwann cells causing
demyelination through cell lysis or an alternation in cell metabolism
• Myelin membrane destruction by virus or viral products

2. Virus-induced immune-mediated reactions

• Antibody and/or cell-mediated reactions to viral antigens on
cell membranes
• Sensitization of host to myelin antigens
ο Breakdown of myelin by infection with introduction into the
circulation (epitope spreading)
ο Incorporation of myelin antigens into virus envelope
ο Modification of antigenicity of myelin membranes
• Cross-reacting antigens between virus and myelin proteins
(molecular mimicry)
• Cytokine and /or protease-mediated demyelination (innocent
bystander effect)

3. Viral disruption of regulatory mechanisms of the immune system

SOURCE: Johnson (1998).

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

46 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

ing diseases have been pursued in hopes of discovering a role of viruses in mul-
tiple sclerosis, but this goal remains elusive.

Animal Models
Animal viruses can produce acute, chronic, and relapsing/remitting demyeli-
nating central nervous system diseases in their natural or experimental hosts (see
Table 1-3). The best model for human postinfectious encephalomyelitis (acute
disseminated encephalomyelitis), however, is not a viral infection but experimen-
tal autoimmune encephalomyelitis (EAE) induced by injection of myelin proteins
with Freund’s adjuvant. The latency, clinical disease, pathology and immuno-
logical features of these two diseases are similar.
Progressive multifocal leucoencephalopathy (PML) in macaque monkeys

TABLE 1-3 Animal Models of Demyelinating Diseases

Virus Family Virus Host Animal Proposed Mechanism
Papoavirus SV40 Monkeys Opportunistic infection of
oligodendrocytes in
immunodeficient animals
Coronavirus Mouse Hepatitis Virus Mice Persistent oligodendrocyte
Rats infection and probable humoral
immune responses
Picornaviruses Theiler’s virus Mice Persistent infection of
oligodendrocytes and
macrophages and immune
responses
Encephalomyocarditis Mice ?
Rhabdovirus Chandipura Mice Cell-mediated immune responses
Vesicular stomatitis virus Mice
Togavirus Semiliki Forest virus Mice Neuronal infection and immune
Venezuelan equine Mice mediated demyelination
encephalitis virus
Ross River virus Mice Direct lysis of oligodendrocytes
Paramyxovirus Canine distemper virus Dogs Predominantly astrocytic
infection with probable
indirect demyelination
Lentivirus Visna virus Sheep Macrophage and monocyte
infection with cytokine-
Caprine arthritis-encephalitis Goats mediated demyelination
virus

SOURCE: Johnson (1998).

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

DEFINING THE RELATIONSHIP 47

caused by SV40 virus is the animal equivalent of PML in man caused by the
related JC virus. As in the human disease, the disease evolves in latently infected
animals when other infections or illnesses cause immunodeficiencies. Four natu-
rally occurring infections in their native hosts have been the most widely studied
models of virus-induced demyelination. Theiler’s virus, a picornavirus, and JHM
virus, a murine coronavirus, were both originally recovered from paralyzed mice;
canine distemper, a morbillivirus closely related to measles virus, has long been
recognized to cause demyelination in a subacute encephalitis called “old dog dis-
ease”; and visna virus, a natural retrovirus infection of sheep, causes relapsing
and remitting disease with multifocal demyelinating lesions after a long incuba-
tion period. Visna and a related caprine lentivirus (caprine arthritis-ecephalitis
virus) best simulate multiple sclerosis, but they have not been widely exploited
because of the need to use sheep or goats as the experiment animals. In these
lentivirus diseases, infection is limited to macrophages and microglia, and demy-
elination is thought to result from cytokines released by infected cells.

Human Demyelinating Diseases of Known Viral Etiology

Postinfectious Encephalomyelitis or Acute Disseminated Encephalomyelitis

(ADEM)
This is an acute perivenular demyelinating disease of the brain and spinal
cord that usually follows viral infections, but on occasions follows some bacterial
infections and vaccines, particularly those containing nervous system tissues.
Historically, the disorder was also known as post-exanthematous encepahlo-
myelitis, since it was most frequent after viral diseases characterized by rashes. In
the 1950s, ADEM constituted one-third of all cases of encephalitis (see Table 1-
4). With the discontinuation of vaccinia virus immunization against smallpox and
introduction of vaccines to prevent measles, mumps, rubella, and chickenpox,

TABLE 1-4 Postinfectious Encephalomyelitis Associated with Exanthematous

Viral Infections
Disease Case rate Fatality rate Sequelae rate
Vaccinia 1:63 to 1:250,000 10% Rare
Measles 1:1,000 25% Frequent
Varicellaa 1:10,000 5% 10%
Rubellaa <1:20,000 20% Very rare
aEstimates are difficult to determine because of the frequency of toxic encephalopathy or Reyes

syndrome (different pathology) and acute cerebellar ataxia (unknown pathology) and the rare docu-
mentation of perivenular demyelinating disease.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

48 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

ADEM constitutes less than one-tenth of the cases of acute encephalitis and now
is most common after nonspecific upper respiratory infections.
The hazard of ADEM after inoculation of vaccinia virus to protect against
smallpox has returned as an issue, since resumption of vaccination is being con-
sidered to counter the possible use of smallpox as a terrorist weapon. A very high
rate of complications in one Dutch vaccination program was presumably due to
use of a more encephalitogenic strain; the low rates during the mass vaccination
in New York in 1947 probably reflects poor surveillance. In Great Britain, during
the more recent outbreak of smallpox in 1962, a rate of postvaccinal encephalo-
myelitis of 1 per 20,000 was estimated, and CDC retrospective surveys estimated
1 per 200,000 in the United States prior to the discontinuation of vaccination.
However, the risk of ADEM when starting vaccination after a hiatus of 30 years
is uncertain, since neurologic complications are more frequent with primary vac-
cination and higher in persons over the age of 20 years.
The clinical presentation of ADEM usually follows the antecedent exanthem
or respiratory or gastrointestinal symptoms by 5 to 21 days. Typically postmeasles
encephalomyelitis occurs 5 to 7 days after the rash when the child is returning to
normal activity. There is the abrupt recurrence of fever, depression of conscious-
ness, and appearance of multifocal neurological findings. The spinal fluid usually
contains myelin basic protein, often shows increased pressure and a mild pleocy-
tosis (but in about one-third of cases, no increased cellularity is found). The MRI
may show very dramatic changes with multiple enhancing lesions in the white
matter.
The histopathology of fatal cases shows perivenular inflammation and de-
myelination throughout the brain and spinal cord. In most instances, virus is not
found within the nervous system. For example, in measles, virus is seldom recov-
erable after the rash which corresponds with the humoral immune response. In
measles, deaths occurring at or before the time of rash, measles virus has been
found in cerebrovascular endothelial cells by in situ PCR; but no virus antigen or
nucleic acid has been found in cells of the CNS in patients dying of encephalomy-
elitis.
The pathogenesis of ADEM is related to infection of immunocompetent cells
and the alteration of immune responses. In both postmeasles and postvaricella
disease activated peripheral blood lymphocytes responsive to myelin basic pro-
tein have been demonstrated. The autoimmune response against CNS myelin ap-
pears to occur without the prerequisite of infection of CNS cells. ADEM appears
to be an autoimmune disease very similar to experimental autoimmune encepha-
lomyelitis.

Progressive Multifocal Leucoencephalopathy (PML)

PML is a subacute demyelinating disease originally described as a rare com-
plication of leukemia and Hodgkin’s disease. Prior to 1982, PML was an extraor-

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

DEFINING THE RELATIONSHIP 49

dinarily rare disease. With the emergence of AIDS over the past two decades,
PML has become a common opportunistic infection causing death in 3–5 percent
of AIDS patients.
The clinical presentation is on a background of severe immunosuppression.
Multifocal neurological symptoms and signs develop insidiously and usually fol-
low an ingravescent course to death. With introduction of HAART therapy and
recovery of T4 counts, stabilization and even improvement has been reported.
There is no fever, no nuchal rigidity, and usually no pleocytosis. A very charac-
teristic MRI pattern is seen, however, with nonenhancing multifocal lesions in
the subcortical white matter.
The neuropathological changes are unique. Plaques of demyelination are seen
preferentially in the grey–white junction. Histologically inflammation is slight or
absent. In areas of demyelination, axons are relatively spared and oligodendro-
cytes are lost. Surrounding these foci, oligodendrocytes are enlarged and contain
intranuclear inclusions. Astocytosis is intense, and many astrocytes contain bi-
zarre mitotic figures and multiple nuclei resembling malignant cells.
Electron microscopic examination of the oligodendrocyte inclusions reveal
profuse pseudocrystalline arrays of papovaviruses. Only occasional viral particles
are seen in astrocytes but they express papovavirus T antigen. JC virus, an ubiq-
uitous human papovavirus, has been associated with almost all cases.
The pathogenesis of demyelination in PML is the opposite of that in ADEM.
JC virus causes an asymptomatic persistent infection in most persons. With in-
tense immunosuppression the virus in some patients is transported to brain, prob-
ably in B cells. With massive replication in oligodendrocytes these cells are de-
stroyed with secondary loss of myelin. There is no evidence of infection of
neurons. Semipermissive infection of astrocytes leads to limited virus production
but many astrocytic changes and proliferation resemble transformation. The tat
protein of HIV may transactivate JC virus accounting for the unique frequency of
PML in HIV-infected patients.

Multiple Sclerosis
A viral cause for multiple sclerosis has been postulated for over 100 years.
Over the past half century this speculation has been highlighted by 3 types of
studies. First, epidemiological evidence implicates childhood exposure factors
(possibly viral infections) in the genesis of multiple sclerosis, and natural history
studies have related “virus-like illnesses” to exacerbations of the disease. Second,
studies of human and animal viral infections have documented that these infec-
tions can have incubation periods of years, cause remitting and relapsing disease
and can cause myelin destruction mediated by a variety of mechanisms. Third,
laboratory studies of patients with multiple sclerosis consistently show that such
patients have greater antibody responses to a variety of viruses than controls and
this includes intrathecal antibody synthesis. This is not to deny the clear-cut ge-

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

50 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

netic susceptibility factor (a concordance of over 30 percent in monozygotic

twins) or the immunologic abnormalities (which may be caused by infection or
be the cause of the unusual viral immune responses in patients).
The unique geographical distribution in temperate zones may in part be ex-
plained by Nordic susceptibility genes, but because many immigration studies
show that migrants after about age 13 take their risk of early homeland with them
and very young migrants acquire the risk of their new land, these findings suggest
a childhood exposure. Apparent outbreaks are recorded such as the increase in
incidence of multiple sclerosis in the Faroe Islands following the British occupa-
tion in World War II. Little evidence is present in these studies to implicate a
specific agent; but there are examples of viruses that show different ages of ac-
quisition. For example, varicella occurs at earlier ages in temperate climates and
Epstein-Barr virus infections at later ages; in addition the severity or presentation
of infection may be age dependent. Early childhood Epstein-Barr virus infection
is asymptomatic whereas young adult infection gives rise to infectious mono-
nucleosis.
Specific viral infections have been suggested by serological and virus isola-
tion studies. Over 30 studies have documented the higher levels of antibody to
measles in serum and spinal fluid in multiple sclerosis patients than in controls.
Although the most striking, measles is not alone as antibodies to many viruses
have been found higher in multiple sclerosis patients (see Table 1-5).
Recovery of viruses from tissues or spinal fluid of patients has been repeat-
edly reported (see Table 1-6), but not with the consistency of serological tests.

TABLE 1-5 Higher Anti-Viral Antibodies in Multiple

Sclerosis Than in Controls
Serum CSF
Measles Measles
Parainfluenza 3 Parainfluenza 1, 2, 3
Influenza C Influenza A, B
Varicella Varicella
Herpes simplex Herpes simplex
Human herpes virus – 6 Human herpes virus – 6
Rubella Rubella
Epstein-Barr Epstein-Barr
Mumps
Respiratory syncytial
Coronaviruses
Adenoviruses
HTLV-I (gag) HTLV-I (gag)
HTLV-II Simian virus-5

SOURCE: Adapted from Johnson (1998).

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

DEFINING THE RELATIONSHIP 51

TABLE 1-6 Viruses Recovered from Patients with Multiple Sclerosis

Virus Year
Rabies virus 1946
1964
Herpes simplex virus, type 2 1964
Scrapie agent 1965
MS-associated agent 1972
Parainfluenza virus 1 1972
Measles virus 1978
Simian virus 5 1979
Chimpanzee cytomegalovirus 1980
Coronavirus 1982
SMON-like virus (subacute myelo-optico-neuropathy) 1982
Tick-borne encephalitis flavivirus 1986
HTLV-1 (human T-cell lymphotrophic virus) 1989
LM7 (retrovirus) 1989
Herpes simplex virus, type 1 1989
Human herpesvirus 6 1994
Endogenous retroviruses 1998

Indeed most have proved to be contaminants picked up from cell cultures or

laboratory animals.
Recent interest has focused on Chlamydia pneumoniae, herpesvirus 6,
Epstein-Barr virus, and endogenous retroviruses as latent or persistent agents
implicated in multiple sclerosis. While they are all normal flora of the human
body, they seem to change in quantity or topography in multiple sclerosis. Again
this raises the tough question of causation versus an epiphenomenon secondary to
the immunological changes in the disease.
Chlamydia commonly causes chronic infection of macrophages, so its recov-
ery from an inflammatory lesion may only reflect the ingress of macrophages.
Similarly Epstein-Barr is latent in B cells, and in a disease such as multiple scle-
rosis, where intrathecal antibody synthesis is taking place, finding it in spinal
fluid or brain by PCR is not surprising. Human herpesvirus 6 has similar latency
and may be nonspecifically activated by a disease exacerbation. Endogenous
retrovirus sequences are present in all our cells, but again nonspecific activation
of macrophages increases the translation of these sequences.
In conclusion, patients with multiple sclerosis have abnormally active im-
mune responses to many viruses, and these responses include intrathecal re-
sponses. Viral infections precede exacerbations of disease more often than can be
explained by chance. The pathogenetic role of viruses in the cause of multiple
sclerosis and the precipitation of exacerbations remain a mystery.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

52 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

REFERENCES
These references are not specifically cited in text.

Buljevac D, Flach HZ, Hop WC, Hijdra D, Laman JD, Savelkoul HF, van Der Meche FG, van Doorn
PA, Hintzen RQ. 2002. Prospective study on the relationship between infections and multiple
sclerosis exacerbations. Brain 125:952–960.
Gieffers J, Pohl D, Treib J, Dittmann R, Stephan C, Klotz K, Hanefeld F, Solbach W, Haass A, Maass
M. 2001. Presence of Chlamydia pneumoniae DNA in the cerebral spinal fluid is a common
phenomenon in a variety of neurological diseases and not restricted to multiple sclerosis. Annals
of Neurology 49:585–589.
Gonzalez-Scarano F and Rima B. 1999. Infectious etiology in multiple sclerosis: the database contin-
ues. Trends in Microbiology 7:475–477.
Johnson RT. 1994. The virology of demyelinating diseases. Annals of Neurology 36:S54–S60.
Johnson RT. 1998. Viral Infections of the Nervous System 2nd Ed. Philadelphia: Lippincott-Raven.
Johnston JB, Silva C, Holden J, Warren KG, Clark AW, Power C. 2001. Monocyte activation and
differentiation augments human retrovirus expression: implications for inflammatory brain dis-
eases. Annals of Neurology 50:434–442.
Wandinger K, Jabs W, Siekhaus A, Bubel S, Trillenberg P, Wagner H, Wessel K, Kirchner H, Hennig
H. 2000. Association between clinical disease activity and Epstein-Barr virus reactivation in
MS. Neurology 55:178–184.
Yao SY, Stratton CW, Mitchell WM, Sriram S. 2000. CSF oligoclonal bands in MS include antibod-
ies against Chlamydophila antigens. Neurology 56:1168–1176.

COMMON INFECTIONS AND UNCOMMON DISEASE:

ELUSIVE ASSOCIATIONS OF ENTEROVIRUSES AND TYPE I
DIABETES MELLITUS
Mark A. Pallansch, Ph.D.; and M. Steven Oberste, Ph.D.
Respiratory and Enteric Viruses Branch,
Division of Viral and Rickettsial Diseases
National Center for Infectious Diseases,
Centers for Disease Control and Prevention, Atlanta, GA

Host genetic determinants have a major influence on an individual’s risk of

developing Type 1 diabetes mellitus (T1DM). At the same time, such environ-
mental factors as foods and infectious agents are thought to play a role in the
genesis of prediabetic autoimmunity or in the progression from persistent beta-
cell autoimmunity to clinical diabetes (Yoon, 1990; See and Tilles, 1998). Immu-
nity to one or more beta cell autoantigens, such as insulin, GAD65, or IA-2, may
lead to destruction of beta cells and a loss of the capacity to produce insulin,
ultimately resulting in clinical insulin-dependent diabetes mellitus. Postulated
mechanisms by which infectious agents may trigger T1DM include:

1. direct cytolytic infection of beta cells, resulting in destruction of beta cells

and loss of capacity to synthesize insulin;

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

DEFINING THE RELATIONSHIP 53

2. a virus-induced immune response against infected beta cells, such as T-

cell induced killing of virus-infected cells;
3. non-specific “innocent bystander” killing of beta cells through activation
of non-specific immune mediators; and
4. induction of an autoimmune response to islet antigens by cross-reactivity
with viral antigens (molecular mimicry) or disruption of normal immune toler-
ance mechanisms.

Several viruses have been proposed as infectious triggers of diabetes, but the
enteroviruses (family Picornaviridae, genus Enterovirus) are the subject of the
most intense scrutiny at present (Leinikki, 1998; Hyöty et al., 1998). Numerous
studies have provided evidence for an association between enterovirus infection
and prediabetic autoimmunity or clinical diabetes. Diabetes incidence has been
epidemiologically linked to the incidence of enteroviral meningitis or enterovirus
outbreaks (Karvonen et al., 1993). Serologic studies have shown that there is a
correlation between enterovirus seroprevalence in patients with prediabetic au-
toimmunity or diabetes, compared to unaffected control individuals (Hiltunen et
al., 1997; Helfand et al., 1995). Direct enterovirus detection in pancreas, blood,
serum, or stool has suggested a temporal correlation between enterovirus infec-
tion and onset of diabetes (Yoon et al., 1979; Andreoletti et al., 1997; Clements et
al., 1995).
Enteroviruses are among the most common of human viruses, infecting an
estimated 50 million people annually in the United States and possibly a billion
or more annually worldwide (Morens and Pallansch, 1995; Pallansch and Roos,
2001). Most infections are inapparent, but enteroviruses may cause a wide spec-
trum of acute disease, including mild upper respiratory illness (common cold),
febrile rash (hand, foot, and mouth disease and herpangina), aseptic meningitis,
pleurodynia, encephalitis, acute flaccid paralysis (paralytic poliomyelitis), and
neonatal sepsis-like disease. Enterovirus infections result in 30,000 to 50,000
hospitalizations per year in the United States, with aseptic meningitis cases ac-
counting for the vast majority of the hospitalizations (Pallansch and Roos, 2001).
In addition to these acute illnesses, enteroviruses have also been associated with
severe chronic diseases such as myocarditis (Martino et al., 1995; Kim et al.,
2001), Type 1 diabetes mellitus (Leinikki, 1998; Rewers and Atkinson, 1995),
and neuromuscular diseases (Dalakas, 1995). Enteroviruses are transmitted pri-
marily by the fecal-oral route but respiratory transmission to close contacts may
also be important. The incubation period between infection and onset of symp-
toms is usually 4–7 days. The intestinal mucosa or upper respiratory tract is the
site of primary infection, with secondary spread to the central nervous system and
other tissues. Viremia is usually short-lived, often waning before the onset of
symptoms, except in very young children. Virus is excreted in the stool for up to
8 weeks (average 2–4 weeks) but maximal virus shedding occurs before the onset

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

54 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

of symptoms. The maximum virus titer in stool is approximately 104 infectious

virus particles per gram.
Of the 89 recognized enterovirus serotypes, 64 are known to infect humans
(Pallansch and Roos, 2001). In addition to the human enteroviruses, human patho-
genic viruses are found in four other picornavirus genera: Rhinovirus (human
rhinoviruses), Hepatovirus (human hepatitis A virus), Parechovirus (human
parechoviruses 1 and 2, formerly echoviruses 22 and 23, respectively), and
Kobuvirus (aichivirus, an agent of gastroenteritis). Most of the human enterovi-
rus serotypes were discovered and described between 1947 and 1963 as a result
of the application of cell culture and suckling mouse inoculation to the investiga-
tion of cases of infantile paralysis (paralytic poliomyelitis) and other central ner-
vous system diseases (Committee on Enteroviruses, 1962; Panel for Picornavi-
ruses, 1963). The human enteroviruses were originally classified on the basis of
human disease (polioviruses), replication and pathogenesis in newborn mice
(coxsackie A and B viruses), and growth in cell culture without causing disease in
mice (echoviruses), but they have recently been reclassified, based largely on
molecular properties, into four species, A through D (King et al., 2000). Se-
quences in various portions of the enterovirus coding-region correlate with spe-
cies, but only capsid sequence correlates with serotype.
The neutralization test, long the gold standard for enterovirus typing, is gen-
erally reliable, but it is labor-intensive and time-consuming, and may fail to iden-
tify an isolate because of aggregation of virus particles or antigenic drift (the
widely used standardized typing antisera were raised against prototype strains
that were isolated 40 to 50 years ago [Lim and Benyesh-Melnick, 1960]). Anti-
sera to all serotypes are not generally available and isolates that are not of a
known human enterovirus serotype (new serotypes or serotypes that normally
infect animals other than humans) would obviously also present difficulties in
identification by antigenic means, as the neutralization method requires the use of
serotype-specific reagents. In addition, neutralization requires virus isolation,
which may require the use of multiple cell lines and adds to the time required to
make an identification.
The application of PCR has improved the speed and accuracy of general
enterovirus detection (Rotbart and Romero, 1995; Rotbart et al., 1997), and has
found wide acceptance in the clinical diagnostic laboratory. Since the enterovirus
serotype is rarely relevant to clinical case management, many clinical virology
laboratories are bypassing virus isolation entirely, in favor of PCR detection of
viral nucleic acid directly in clinical specimens such as cerebrospinal fluid, naso-
pharyngeal swabs, or tissue specimens (Rotbart and Romero, 1995). This ap-
proach uses genus-specific primers targeted to the 5′ non-translated region (see
Figure 1-6), often coupled to probe-hybridization and detection of product in a
microplate format (Rotbart and Romero, 1995). Specimens of choice for the di-
rect detection of enteroviruses by RT-PCR are stool or rectal swab (stool is pre-
ferred because it contains a larger amount of fecal material and, hence, virus);

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

DEFINING THE RELATIONSHIP 55

P1 P2 P3
5'NTR 3'NTR
VP4 VP2 VP3 VP1 2A 2B 2C 3A 3B 3C 3D

5’ NTR
RT-snPCR
012 011
040
187 222
VP3/VP1 188 VP1/2A
189
292

VP1 PCR for molecular serotyping

FIGURE 1-6 Schematic representation of the enterovirus genome, indicating regions that
have been targeted for development of PCR diagnostics. The genome is a positive-stranded,
polyadenylated RNA of ~7400 nucleotides, with a viral protein (3B/VPg) covalently linked
to the 5′ end. The genome is divided into five functional regions: the 5′ non-translated
region (NTR) (control of viral translation initiation and initiation of positive-strand RNA
synthesis); P1 (encodes the structural proteins that comprise the virus capsid); P2 and P3
(encode the non-structural proteins involved in RNA replication, proteolytic processing of
polyprotein, and host cell shut-down); and 3′ NTR (involved in initiation of negative-
strand RNA synthesis).

oro- or nasopharyngeal specimens (throat swab, nasopharyngeal swab or aspi-

rate, saliva); cerebrospinal fluid (if there is concomitant CNS disease); fresh-
frozen or formalin-fixed tissue; and serum/plasma. Serum and plasma are gener-
ally only useful for RT-PCR in infants because viremia may still be present after
onset of symptoms. If virus is detected only in a non-sterile site, such as stool or
nasopharynx, a large number of patients are needed to establish the association
between infection and disease.
Despite the advantages of enterovirus detection by RT-PCR, challenges re-
main. In the case of chronic diseases, the virus may act indirectly (e.g., through
immune-mediated pathology). The virus may be cleared well before disease on-
set or virus may be present in the patient but not in the diseased tissue. Even in
acute illnesses, the titer is relatively low in all specimens. As a result, a conven-
tional single-step RT-PCR amplification may not be sensitive enough for direct
detection from the original clinical specimen. Designing a prospective study and
collecting multiple specimens, at multiple time points throughout the duration of
the study, may overcome some of these problems; however, the only way to solve
the sensitivity problem is by increasing the sensitivity of the detection method.
To address this issue, we have developed an enterovirus-specific semi-nested
RT-PCR assay (5′ NTR RT-snPCR) that targets the conserved regions of the 5′
NTR (see Figure 1-6). Figure 1-7 shows the sensitivity of our standard, conven-
tional RT-PCR (Yang et al., 1992) compared with that of the 5′ NTR RT-snPCR.
Ten-fold serial dilutions of a virus isolate (10–1 to 10–10) were prepared with
uninfected cell extract as diluent. RNA was extracted using the QIAamp viral
RNA mini-kit (Qiagen Inc., Valencia, CA) and reverse-transcribed using the

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

56 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

A Dilution: 10 x
M –1 –2 –3 –4 –5 –6 –7 –8 –9 –10 M

x
B Dilution: 10
M –1 –2 –3 –4 –5 –6 –7 –8 –9 –10 M

FIGURE 1-7 Sensitivity of pan-enterovirus RT-PCR methods. M-molecular weight

marker. Virus dilutions are shown at the top of each panel. A. Titration of conventional
two-primer RT-PCR. B. Titration of RT-semi-nested (three-primer) PCR.

antisense primer. PCR was performed using a single round of amplification (con-
ventional PCR) or two rounds of amplification (semi-nested PCR). The second
round of the semi-nested amplification used the same primers as the conventional
PCR. Amplification products were visualized by polyacrylamide gel electrophore-
sis and staining with ethidium bromide. The RT-snPCR method (see Figure 1-
7B) was approximately 10,000-fold more sensitive than the conventional RT-
PCR (see Figure 1-7A). The 10–7 dilution corresponds to less than 20 infectious
virus particles.
Enterovirus infection elicits a serotype-specific immune response directed
against epitopes on the surface of the viral capsid. Mucosal immunity is most
important. Antibody alone fully protects from disease, probably by limiting virus
spread from the gut, but antibody does not necessarily protect from infection. The
virus-specific T-cell response, directed against epitopes on both the structural and
non-structural proteins, is probably involved in virus clearance but it is not needed
for protection. Antigenic sites are located in each of the three enterovirus struc-
tural proteins, VP1, VP2, and VP3 (Minor, 1990; Mateu, 1995), but the epitopes
responsible for serotype specificity have not been identified. Since the picornavi-
rus VP1 protein contains a number of immunodominant neutralization domains,
we hypothesized that VP1 sequence should correspond with neutralization prop-
erties (serotype) (Oberste et al., 1999b). Due to the high frequency of recombina-
tion among picornaviruses (Kopecka et al., 1995; King, 1988; Santti et al., 1999),

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

DEFINING THE RELATIONSHIP 57

sequence information from non-capsid regions is of little value in characterizing

new serotypes within known genera.
Practical criteria must be established before molecular sequence information
can be applied routinely to picornavirus identification. A partial or complete VP1
nucleotide sequence identity of at least 75 percent (minimum 85 percent amino
acid sequence identity) between a clinical enterovirus isolate and serotype proto-
type strain may be used to establish the serotype of the isolate (Oberste et al.,
1999a,b, 2000). These criteria also appear to apply to comparisons among iso-
lates of foot-and-mouth-disease virus (family Picornaviridae, genus Aphthovirus)
(Vosloo et al., 1992), but a study directly comparable to the enterovirus studies
has not yet been performed. A best-match nucleotide sequence identity of be-
tween 70 percent and 75 percent or a second-highest score of greater than 70
percent may provide a tentative identification, pending confirmation by other
means, such as neutralization with monospecific antisera (Oberste et al., 2000) or
more extensive sequencing. A best-match nucleotide sequence identity below 70
percent (less than 85 percent amino acid sequence identity) may indicate that the
isolate represents an unknown serotype (Oberste et al., 2000, 2001). Sequencing
of the complete capsid-coding region may be useful in confirming this result, but
complete capsid sequences are available for less than half of the known enterovi-
rus serotypes, limiting the utility of complete capsid sequence comparisons until
more sequence becomes available. More extensive characterization, possibly in-
cluding complete genome sequences, may be required for viruses that appear to
represent previously unknown genera (Hyypiä et al., 1992; Marvil et al., 1999;
Niklasson et al., 1999; Yamashita et al., 1998).
Recognizing the technical difficulties and limitations inherent in the classic
approach to enterovirus identification, we developed RT-PCR and sequencing
primers that target the VP1 capsid gene and may be used to determine enterovirus
serotype by sequencing of the amplicon and comparison to a database of the VP1
sequences of all enterovirus serotypes (Oberste et al., 1999a,b, 2000). These mo-
lecular detection and typing methods, when coupled with well-designed prospec-
tive studies, will be useful in addressing the potential causal relationship between
enterovirus infection and development of prediabetic autoimmunity or progres-
sion from persistent autoimmunity to clinical diabetes.

REFERENCES
Andreoletti L, Hober D, Hober-Vandenberghe C, Belaich S, Vantyghem MC, Lefebvre J, Wattre P.
1997. Detection of coxsackie B virus RNA sequences in whole blood samples from adult pa-
tients at the onset of type I diabetes mellitus. Journal of Medical Virology 52:121–127.
Clements GB, Galbraith DN, Taylor KW. 1995. Coxsackie B virus infection and onset of childhood
diabetes. Lancet 346:221–223.
Committee on Enteroviruses. 1962. Classification of human enteroviruses. Virology 16:501–504.
Dalakas MC. 1995. Enteroviruses and human neuromuscular diseases. Pp. 387–398 in Human En-
terovirus Infections, HA Rotbart, ed. Washington, DC: ASM Press.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

58 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

Helfand RF, Gary HE Jr, Freeman CY, Anderson LJ, Pallansch MA. 1995. Serologic evidence of an
association between enteroviruses and the onset of type 1 diabetes mellitus. Pittsburgh Diabetes
Research Group. The Journal of Infectious Diseases 172:1206–1211.
Hiltunen M, Hyoty H, Knip M, Ilonen J, Reijonen H, Vahasalo P, Roivainen M, Lonnrot M, Leinikki
P, Hovi T, Akerblom HK. 1997. Islet cell antibody seroconversion in children is temporally
associated with enterovirus infections. Childhood Diabetes in Finland (DiMe) Study Group. The
Journal of Infectious Diseases 175:554–560.
Hyöty H, Hiltunen M, Lonnrot M. 1998. Enterovirus infections and insulin dependent diabetes mel-
litus—evidence for causality. Clinical and Diagnostic Virology 9:77–84.
Hyypiä T, Horsnell C, Maaronen M, Khan M, Kalkkinen N, Auvinen P, Kinnunen L, Stanway G.
1992. A distinct picornavirus group identified by sequence analysis. Proceedings of the Na-
tional Academy of Sciences 89:8847–8851.
Karvonen M, Tuomilehto J, Libman I, LaPorte R. 1993. A review of the recent epidemiological data
on the worldwide incidence of type 1 (insulin-dependent) diabetes mellitus. World Health
Organisation DIAMOND Project Group. Diabetologia 36:883–892.
Kim KS, Hufnagel G, Chapman NM, Tracy S. 2001. The group B coxsackieviruses and myocarditis.
Reviews in Medical Virology 11:355–368.
King AMQ. 1988. Genetic recombination in positive strand RNA viruses. Pp. 149–165 in RNA Ge-
netics, E Domingo, JJ Holland, and P Ahlquist, eds. Boca Raton, FL: CRC Press, Inc.
King AMQ et al. 2000. Picornaviridae. Pp. 657–678 in Virus Taxonomy: Seventh Report of the
International Committee on Taxonomy of Viruses, MH Van Regenmortel et al., eds. San Diego:
Academic Press.
Kopecka H, Brown B, Pallansch M. 1995. Genotypic variation in coxsackievirus B5 isolates from
three different outbreaks in the United States. Virus Research 38:125–136.
Leinikki P. 1998. Viruses and type 1 diabetes: elusive problems and elusive answers. Clinical and
Diagnostic Virology 9:65–66.
Lim KA and Benyesh-Melnick M. 1960. Typing of viruses by combinations of antiserum pools.
Application to typing of enteroviruses (coxsackie and ECHO). Journal of Immunology 84:309–
317.
Martino TA et al. 1995. Enteroviral myocarditis and cardiomyopathy: a review of clinical and experi-
mental studies. Pp. 291–351 in Human Enterovirus Infections, HA Rotbart, ed. Washington,
DC: ASM Press.
Marvil P, Knowles NJ, Mockett AP, Britton P, Brown TD, Cavanagh D. 1999. Avian encephalomy-
elitis virus is a picornavirus and is most closely related to hepatitis A virus. Journal of General
Virology 80:653–662.
Mateu MG. 1995. Antibody recognition of picornaviruses and escape from neutralization. Virus Re-
search 38:1–24.
Minor PD. 1990. Antigenic structure of picornaviruses. Current Topics in Microbiology and Immu-
nology 161:121–154.
Morens DM and Pallansch MA. 1995. Epidemiology. Pp. 3–23 in Human Enterovirus Infections, HA
Rotbart, ed. Washington, DC: ASM Press.
Niklasson B, Kinnunen L, Hornfeldt B, Horling J, Benemar C, Hedlund KO, Matskova L, Hyypia T,
Winberg G. 1999. A new picornavirus isolated from bank voles (Clethrionomys glareolus).
Virology 255:86–93.
Oberste MS, Maher K, Kilpatrick DR, Flemister MR, Brown BA, Pallansch MA. 1999a. Typing of
human enteroviruses by partial sequencing of VP1. Journal of Clinical Microbiology 37:1288–
1293.
Oberste MS, Maher K, Kilpatrick DR, Pallansch MA. 1999b. Molecular evolution of the human
enteroviruses: correlation of serotype with VP1 sequence and application to picornavirus classi-
fication. Journal of Virology 73:1941–1948.
Oberste MS, Maher K, Flemister MR, Marchetti G, Kilpatrick DR, Pallansch MA. 2000. Comparison
of classic and molecular approaches for the identification of “untypable” enteroviruses. Journal
of Clinical Microbiology 38:1170–1174.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

DEFINING THE RELATIONSHIP 59

Oberste MS, Schnurr D, Maher K, al-Busaidy S, Pallansch M. 2001. Molecular identification of new
picornaviruses and characterization of a proposed enterovirus 73 serotype. Journal of General
Virology 82:409–416.
Pallansch MA and Roos RP. 2001. Enteroviruses: polioviruses, coxsackieviruses, echoviruses, and
newer enteroviruses. Pp. 723–775 in Fields Virology, DM Knipe and PM Howley, eds. Phila-
delphia: Lippincott Williams and Wilkins.
Panel for Picornaviruses. 1963. Picornaviruses: classification of nine new types. Science 141:153–
154.
Rewers M and Atkinson M. 1995. The possible role of enteroviruses in diabetes mellitus. Pp. 353–
385 in Human Enterovirus Infections, HA Rotbart, ed. Washington, DC:ASM Press.
Rotbart HA and Romero JR. 1995. Laboratory diagnosis of enteroviral infections. Pp. 401–418 in
Human Enterovirus Infections, HA Rotbart, ed. Washington, DC: ASM Press.
Rotbart HA, Ahmed A, Hickey S, Dagan R, McCracken GH Jr, Whitley RJ, Modlin JF, Cascino M,
O’Connell JF, Menegus MA, Blum D. 1997. Diagnosis of enterovirus infection by polymerase
chain reaction of multiple specimen types. The Pediatric Infectious Disease Journal 16:409–
411.
Santti J, Hyypia T, Kinnunen L, Salminen M. 1999. Evidence of recombination among enteroviruses.
Journal of Virology 73:8741–8749.
See DM and Tilles JG. 1998. The pathogenesis of viral-induced diabetes. Clinical and Diagnostic
Virology 9:85–88.
Vosloo W, Knowles NJ, Thomson GR. 1992. Genetic relationships between southern African SAT-2
isolates of foot-and-mouth-disease virus. Epidemiology and Infection 109:547–558.
Yamashita T, Sakae K, Tsuzuki H, Suzuki Y, Ishikawa N, Takeda N, Miyamura T, Yamazaki S. 1998.
Complete nucleotide sequence and genetic organization of Aichi virus, a distinct member of the
Picornaviridae associated with acute gastroenteritis in humans. Journal of Virology 72:8408–
8412.
Yang CF, De L, Yang SJ, Ruiz Gomez J, Cruz JR, Holloway BP, Pallansch MA, Kew OM. 1992.
Genotype-specific in vitro amplification of sequences of the wild type 3 polioviruses from
Mexico and Guatemala. Virus Research 24:277–296.
Yoon JW. 1990. The role of viruses and environmental factors in the induction of diabetes. Current
Topics in Microbiology and Immunology 164:95–123.
Yoon JW, Austin M, Onodera T, Notkins AL. 1979. Isolation of a virus from the pancreas of a child
with diabetic ketoacidosis. New England Journal of Medicine 300:1173–1179.

INFECTIOUS AGENTS AND SCHIZOPHRENIA*

Robert H. Yolken
Johns Hopkins School of Medicine, Baltimore, MD
E. Fuller Torrey
Stanley Medical Research Institute, Bethesda, MD

Schizophrenia is a pervasive neuropsychiatric disorder of worldwide impor-

tance. This disease and related serious psychiatric diseases exact an enormous
cost in terms of medical resources, lost productivity, and social ills such as crime
and homelessness (see Box 1-2). Despite more than 100 years of extensive re-
search, the causes of schizophrenia remain obscure. Much of the recent research

*The research described in this presentation was supported by the Stanley Medical Research Insti-
tute.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

60 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

Box 1-2
Clinical and Epidemiological Features of Schizophrenia

Positive symptoms:

• Hallucinations
• Delusions
• Disordered thinking

Negative symptoms:

• Withdrawal
• Amotivation
• Retricted expressiveness

Impairment in cognitive and social functioning

Structural and functional brain abnormalities
Lifetime prevalence = ~1 percent
Peak onset of symptoms in young adulthood
Significant societal consequences worldwide

Characteristics of available medicines:

• Symptomatic improvement
• High rate of side effects
• Do not affect overall disease process

in schizophrenia has focused on possible genetic etiologies. The rationale for this
approach is based on numerous studies indicating a strong risk associated with
having a biological parent with this disease. Extensive genetic analyses of fami-
lies with schizophrenia have led to the identification of a number of broad ge-
nomic regions which appear to be inherited in a non-random fashion by individu-
als with schizophrenia. However, despite intensive searches, no genes of major,
or even minor effect, have been consistently linked to the schizophrenia pheno-
type (see Box 1-3).
Due to the limited success of genetic investigations, there has been renewed
interest in the role of environmental factors in the etiopathogenesis of schizophre-
nia. This approach derives its rationale from a number of epidemiological studies
which indicate that environmental factors may contribute to the risk of schizo-
phrenia in some individuals. Many of these studies identify environmental events
occurring during fetal development and early infancy as risk factors for the devel-
opment of schizophrenia in adult life. Risk factors which have been identified

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

DEFINING THE RELATIONSHIP 61

Box 1-3
Genetics of Schizophrenia

Increased incidence in biological first-degree relatives:

• General Population ~1 percent

• First Degree Relatives ~7–9 percent
• Monozygotic Twins ~30 percent

Most individuals with schizophrenia lack a first degree relative with

the disease.
Genetic factors have a large relative risk but a small risk (5 percent)
in the overall population.

Intensive search for genes using molecular methods:

• Multiple chromosomal regions of linkage

• Genetic polymorphisms of minor effect (OR-2)
• No genes of major effect in different populations

include infections, nutritional deprivation, and animal exposures in pregnancy

(Yolken and Torrey, 1995; Torrey et al., 2000). Additional studies have docu-
mented an association between risk of schizophrenia with place and season of
birth (Torrey et al., 1997; Torrey and Yolken, 1998). While the relative risks
associated with these factors are relatively modest, the common nature of these
exposures indicates that they may have a large effect on a population basis
(Mortensen et al., 1999).
Based on this background, we have devised the working hypothesis that most
cases of schizophrenia are caused by infections and other environmental events
occurring in genetically susceptible individuals (Torrey and Yolken, 2000). It is
of note that infections relating to schizophrenia occurring in this context would
not be expected to follow satisfy Koch’s postulates since they would not lead to
disease in individuals who did not have the appropriate genetic susceptibility. It
is also likely that different microbial agents could lead to a similar disease pro-
cess in individuals who share common genetic predispositions. It will thus be
necessary to move beyond Koch’s postulates in order to analyze the interaction
between genetic and environmental factors as causative agents of schizophrenia
and other serious psychiatric diseases.
We have applied a number of laboratory techniques to the examination of
these hypotheses (Johnston-Wilson et al., 2001). These techniques have been used
to analyze brain tissues obtained postmortem from individuals with psychiatric
diseases and control conditions. These brains were obtained by the Stanley Foun-

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

62 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

dation from a consortium of neuropathologists located in several different re-

gions of the United States and are available to researchers with an interest in the
studies of these disorders.
One of the most informative techniques which we have applied to these
samples has been that of differential display. This method has indicated that there
are several differences in RNA transcription in the brains of individuals with
schizophrenia as compared to unaffected controls (Yee and Yolken, 1997). Se-
quence analysis of differentially expressed transcripts has indicated that many
have a high degree of homology with a range of endogenous retroviruses. These
elements are components of the human genome which arose from retro-
transposition of infectious retroviruses in our evolutionary past. Endogenous
retroviruses are integrated into the human genome. Upon activation, they can
modulate the transcription of genes located upstream or downstream from the site
of chromosomal integration (see Figure 1-8). Since they share properties of both
genes and infectious agents, they are a potential link between genetic and envi-
ronmental causes of human disease (Yolken et al., 2000).
Further studies were performed on cerebrospinal fluids (CSFs) obtained from
living individuals with early symptoms of schizophrenia. Amplification of RNA
extracted from these fluids indicated an increased rate of transcription of an en-
dogenous retrovirus called HERV-W. This endogenous retrovirus was found in
the CSFs of approximately 30 percent of individuals with recent-onset schizo-
phrenia and 5 percent of individuals with chronic forms of the disease (see Figure
1-9). HERV-W transcription was not detected in the CSF of individuals without
psychiatric disorders (Karlsson et al., 2001). HERV-W is of interest since its

Parasite Virus Hormone Cytokine

T. gondii HSV-1 Testosterone TNF-α

Genomic DNA 5'LTR gag- pol -env 3'LTR Transcribed RNA

FIGURE 1-8 Integration and transcription of endogenous retroviruses.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

DEFINING THE RELATIONSHIP 63

DNA
Scz

Ctr
Herv-W
HERVw GTTCAGGGATAGCCCCCATCTATTTGGCCAGGCATTAGCCCAAGACTTGAGTCAATTCTCATACCTGGACACTCTTGTCCTTCAG
C1 C
A1 A TG
A2 A TG
A3 C C G- G
A4 A T C G TG
A5 A
A6 T CA TA C G TG

FIGURE 1-9 Endogenous retrovirus was found in the CSFs of approximately 30 percent
of individuals with recent-onset schizophrenia and 5 percent of individuals with chronic
forms of the disease.
SOURCE: Karlsson et al. (2001).

transcription has also been found to be increased in the CSFs of individuals with
multiple sclerosis (Perron et al., 1997). It has also been demonstrated to be active
during human fetal development and to encode a protein with syncytium forming
activity in the human placenta (Mi et al., 2000). Furthermore , the envelope pro-
tein of HERV-W is capable of causing polyclonal T-lymphocyte activation (Per-
ron et al., 2001). HERV-W may thus also provide a link between environmental
events active both during fetal development and adult life.
The transcription of endogenous retroviruses can be activated by a number of
infectious agents and other environmental factors. We have examined the preva-
lence of potential activating infections in different stages of schizophrenia. We
have found an increased level of antibodies to Toxoplasma gondii in individuals
with the recent onset of schizophrenia (see Figure 1-10) (Yolken et al., 2001).
This finding is consistent with epidemiological studies documenting an increased
rate in schizophrenia in individuals who were exposed to cats in early life (Torrey
et al., 2000). We have also found that serological evidence of infection with Her-
pes Simplex Virus Type 1 and Toxoplasma gondii are associated with increased
levels of cognitive and memory impairments in individuals with established forms
of schizophrenia (Dickerson et al., 2003b). We also examined the possible asso-
ciation between infections in pregnancy in the occurrence of schizophrenia in

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

64 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

2 1.00

p <0.02 p <0.001 p <0.0002 0.90

Optical Density (lgM and IgA)

0.80
Optical Density (lgG)

0.70

0.60

1 0.50

0.40

0.30

0.20

0.10

0 0.00
Case Control Case Control Case Control

IgG IgM IgA

FIGURE 1-10 An increased level of antibodies to Toxoplasma gondii is found in indi-
viduals with recent onset of schizophrenia.
SOURCE: Yolken et al. (2001).

later life. These analyses were accomplished by the testing of sera which had
been obtained from healthy pregnant women as part of the National Collaborative
Perinatal Study performed in the United States during the 1950s and 1960s. Ini-
tial analyses of this cohort indicates that the offspring of mothers who had evi-
dence of infection, as indicated by increased levels of IgG, IgM, and of IgG
antibodies to Herpes Simplex Virus type 2, have higher rates of schizophrenia in
adult life (see Figure 1-11) (Buka et al., 2001). There was also a risk of schizo-
phrenia associated with IgM antibodies to Toxoplasma gondii, although the anti-
genic source of these antibodies is still under investigation.
These studies indicate that infectious agents play a role in the generation of
schizophrenia in some individuals. The activation of endogenous retroviruses
within the central nervous system is likely to be one of several mechanisms by
means of which infections can lead to disease. If this is the case, it is possible that
the treatment of infectious agents which activate retroviral transcription may be
capable of modulating the course of disease at different times in the lifelong
course of disease. For example, the treatment of active infection with herpes sim-
plex virus might prevent endogenous retrovirus activation due to this organism. It
is of note in this regard that several of the medications which are commonly used
for the treatment of schizophrenia also have the ability to inhibit the replication of
infectious agents (Jones-Brando et al., 1997). Preliminary analysis of a clinical

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

DEFINING THE RELATIONSHIP 65

FIGURE 1-11 Association between HSV infections in pregnant women and the occur-
rence of schizophrenia in their adult offspring. The adult offspring of mothers whose sera
showed evidence of HSV infection during pregnancy have higher rates of schizophrenia
than the adult offspring of mothers whose sera did not show such evidence during pregnancy.
SOURCE: Reprinted from Buka et al. (2001).

trial of the anti-herpesvirus medication valacyclovir indicates that it is effective

in reducing the symptoms of some individuals with schizophrenia (Dickerson et
al., 2003a). Ongoing studies are directed at the further evaluation of the role of
anti-viral and anti-parasitic agents in the treatment of schizophrenia. The defini-
tive establishment of the role of infectious agents in the etiopathogenesis of
schizophrenia may lead to new methods for the diagnosis, prevention, and treat-
ment of this devastating disease.

REFERENCES
Buka SL, Tsuang MT, Torrey EF, Klebanoff MA, Bernstein D, Yolken RH. 2001. Maternal infections
and subsequent psychosis among offspring. Archives of General Psychiatry 58:1032–1037.
Dickerson F, Boronow JJ, Stallings C, Origoni A, Yolken R. 2003a. Valacyclovir reduces symptoms
in individuals with schizophrenia who are seropositive for cytomegalovirus. Paper presented at
the International Congress on Schizophrenia Research, Colorado Springs, March 2003.
Dickerson FB, Boronow JJ, Stallings C, Origoni AE, Ruslanova I, Yolken RH. 2003b. Association of
serum antibodies to herpes simplex virus 1 with cognitive deficits in individuals with schizo-
phrenia. Archives of General Psychiatry 60:466–472.
Johnston-Wilson NL, Bouton CM, Pevsner J, Breen JJ, Torrey EF, Yolken RH. 2001. Emerging
technologies for large-scale screening of human tissues and fluids in the study of severe psychi-
atric disease. The International Journal of Neuropsychopharmacology 4:83–92.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

66 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

Jones-Brando LV, Buthod JL, Holland LE, Yolken RH, Torrey EF. 1997. Metabolites of the
antipsycotic agent clozapine inhibit the replication of human immunodeficiency virus type 1.
Schizophrenia Research 25:63–70.
Karlsson H, Bachmann S, Schroder J, McArthur J, Torrey EF, Yolken RH. 2001. Retroviral RNA
identified in the cerebrospinal fluids and brains of individuals with schizophrenia. Proceedings
of the National Academy of Sciences 98:4634–4639.
Mi S, Lee X, Li X, Veldman GM, Finnerty H, Racie L, LaVallie E, Tang XY, Edouard P, Howes S,
Keith JC Jr, McCoy JM. 2000. Syncytin is a captive retroviral envelope protein involved in
human placental morphogenesis. Nature 403:785–789.
Mortensen PB, Pederson CB, Westergaard T, Wohlfahrt J, Ewald H, Mors O, Andersen PK, Melbye
M. 1999. Effects of family history and place and season of birth on the risk of schizophrenia.
New England Journal of Medicine 340:603–608.
Perron H, Garson JA, Beden F, Beseme F, Paranhos-Baccala G, Komurian-Pradel F, Mallet F, Tuke
PW, Voisset C, Blond JL, Lalande B, Seigneurin JM, Mandrand B. 1997. Molecular identifica-
tion of a novel retrovirus repeatedly isolated from patients with multiple sclerosis. The Collabo-
rative Research Group on Multiple Sclerosis. Proceedings of the National Academy of Sciences
94:7583–7588.
Perron H, Jouvin-Marche E, Michael M, Quanonian-Paroz A, Camelo S, Dumon A, Jolivet-Reynaud
C, Marcel F, Souillet Y, Barel E, Gebeihrer L, Santoro L, Marcel S, Seigreurin JM, Marche PN,
Lafon M. 2001. Multiple sclerosis retrovirus particles and recombinant envelope trigger on
abnormal immune response in vitro, by inducing polyclonal Vbetal 6 T-lymphocyte activation.
Virology 287:321–332.
Torrey EF and Yolken RH. 1998. At issue: is household crowding a factor for schizophrenia and
bipolar disorder. Schizophrenia Bulletin 24:321–324.
Torrey EF and Yolken RH. 2000. Familial and genetic mechanisms in schizophrenia. Brain Research
Reviews 31:113–117.
Torrey EF, Miller J, Rawlings R, Yolken RH. 1997. Seasonality of births in schizophrenia and bipolar
disorder: a review of the literature. Schizophrenia Research 28:1–38.
Torrey EF, Rawlings R, Yolken RH. 2000. The antecedents of psychoses: a case-control study of
selected risk factors. Schizophrenia Research 46:17–23.
Yee F and Yolken RH. 1997. Identification of differentially expressed RNA transcripts in neuropsy-
chiatric disorders. Biological Psychiatry 41:759–761.
Yolken RH and Torrey EF. 1995. Viruses, schizophrenia and bipolar disorder. Clinical Microbiology
Reviews 8:131–145.
Yolken RH, Karlsson H, Yee F, Johnston-Wilson NL, Torrey EF. 2000. Endogenous retroviruses and
schizophrenia. Brain Research Reviews 31:193–199.
Yolken RH, Bachmann S, Rouslanova I, Lillehoj E, Ford G, Torrey EF, Schroeder J. 2001. Antibod-
ies to Toxoplasma gondii in individuals with first-episode schizophrenia. Clinical Infectious
Diseases 32:842–844.

OVINE PULMONARY ADENOCARCINOMA:

IDENTIFYING THE CAUSATIVE AGENT FOR A NEOPLASTIC
DISEASE AND IMPLICATIONS FOR HUMAN LUNG CANCER
Hung Fan, Ph.D.
Department of Molecular Biology and Biochemistry
Cancer Research Institute, University of California, Irvine, CA

Cancer is a collection of diseases that result from uncontrolled cell growth.

Progression from a normal cell to a fully malignant one is a multi-step process,

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

DEFINING THE RELATIONSHIP 67

and numerous factors can contribute. Over the years, it has been shown that envi-
ronmental factors (e.g., radiation and heavy metals) and lifestyle habits (e.g.,
tobacco smoking) can increase the rates of particular cancers. In some cases,
infectious agents have been identified as causative to certain cancers. In animal
model systems, several classes of viruses have been shown to cause cancers,
including retroviruses (e.g., avian sarcoma/leukemia viruses and murine leuke-
mia viruses) and small DNA viruses (e.g., polyoma and SV40). Viruses associ-
ated with human cancers include retroviruses (human T-cell leukemia virus—
adult T-cell leukemia), human papillomavirus (cervical cancer), hepatitis virus
types B and C (hepatocellular carcinoma) and gamma herpes viruses (EBV—
lymphomas and nasopharyngeal carcinoma; HHV8—Kaposi’s sarcoma). In ad-
dition, the bacterium Helicobacter pylori has been associated with stomach can-
cer. Proving the involvement of viruses and bacteria in human cancers has
typically taken many years. Steps involved include appreciating an epidemiologi-
cal pattern of the particular cancer suggesting an infectious agent, identification
of an infectious agent whose distribution fits the epidemiological pattern, and
ultimately demonstrating in an animal model or in vitro culture system that the
putative infectious agent is carcinogenic.
Lung cancer is one of the most common human neoplasms. While a substan-
tial portion of lung cancer can be attributed to tobacco smoking, other factors
may also contribute to development of disease. Moreover, in some cases tobacco
smoking is not involved in causation of the tumor. Human adenocarcinoma of the
lung represents neoplasms of secretory epithelia cells. In the distal airways (al-
veoli and bronchioles), the targets of transformation are Type II pneumocytes and
Clara cells. Bronchiolo alveolar carcinoma (BAC) is a sub-classification of lung
adenocarcinoma in which the tumor cells line the alveoli or bronchioles and spread
in a sideways (lepidic) fashion (Mornex et al., 2003). BAC does not appear to be
tightly associated with tobacco smoking, and the incidence of this cancer may be
rising. Thus the possibility that an infectious agent may be involved in BAC or
human lung adenocarcinoma in general has been suggested by a number of inves-
tigators (Jackson et al., 2000; Koyi et al., 2001; Laurila et al., 1997).
A very interesting animal model for human lung adenocarcinoma exists:
ovine pulmonary adenocarcinoma (OPA), a contagious lung cancer of sheep (Fan,
2003). The disease was first described in the late 1800s in South Africa, and was
named jaagsiekte—“driving sickness” in Afrikaans (York and Querat, 2003). The
disease is prevalent worldwide, and is particularly well-documented in Europe
and Africa. It is estimated that the lifetime risk of developing OPA in high inci-
dence flocks is approximately 25 percent (Sharp and DeMartini, 2003). The
spread of OPA may result from inhalation of aerosols. A noteworthy feature of
the disease is production of excess surfactant by the tumor cells—the normal
function of Type II pneumocytes and Clara cells is to produce lung surfactant and
other molecules important for lung physiology. As a result, animals with end-
stage OPA exhibit respiratory distress; “tipping” of OPA animals results in lung

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

68 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

fluid (excess surfactant) draining from the nose. In the mid-1970s, researchers in
the United Kingdom showed that filtered OPA lung fluid could transfer the dis-
ease to unaffected animals, indicating a viral etiology of OPA (York and Querat,
2003). In the 1960s and 1970s, further evidence was obtained that supported this
notion. In particular, OPA lung fluid was shown to contain reverse transcriptase
activity (characteristic of retroviruses), and OPA lung fluid was shown to contain
antigens that cross-react with two retroviruses—Mason Pfizer monkey virus
(MPMV) and murine mammary tumor virus (MMTV) (Sharp and Herring, 1983).
MPMV and MMTV are relatively closely related viruses, belonging to the
betaretrovirus class. However, the experiments were complicated by the presence
of another retrovirus, an ovine lentivirus, that was also present in many of the
animals with OPA. This confounded experiments to isolate and purify the caus-
ative agent of OPA. Moreover, attempts to propagate the OPA-inducing virus
from lung fluid in tissue culture were unsuccessful. A major advance was made in
1990, when York et al. deduced the presence and sequence of a novel retrovirus
in OPA lung fluid (York et al., 1991, 1992). This was accomplished by first
developing a technique that partially removed the contaminating ovine lentivirus
from the OPA lung fluid (treatment with a fluorocarbon). The treated lung fluid
was then banded to equilibrium in a sucrose density gradient, and RNA was
extracted from the peak of reverse transcriptase activity. This RNA was then
reverse transcribed in vitro using purified reverse transcriptase and an oligodT
primer, and a series of overlapping partial cDNA clones was obtained. Sequenc-
ing of the cDNA clones and overlapping the resulting sequences revealed a novel
complete retroviral sequence; this retrovirus was designated jaagsiekte sheep
retrovirus or JSRV. Consistent with the previous serology, sequence homology
analyses indicated that JSRV is also a beta retrovirus, with sequence similarities
to both MPMV and MMTV. A diagram of the JSRV sequence is shown in Figure
1-12. Disappointingly, attempts to isolate a replication-competent retrovirus from
assembled cDNA clones were unsuccessful.
The availability of the JSRV sequence allowed generation of important mo-
lecular reagents for detection of the putative virus. Initial Southern blot experi-
ments indicated that, as for many other retroviruses, endogenous JSRV-related
proviruses are present in the germ line of all sheep and goats (DeMartini et al.,
2003; Hecht et al., 1996; York et al., 1991). There are 15–20 endogenous JSRV-
related proviruses in most sheep. On an evolutionary scale, these endogenous
viruses entered the sheep germ line relatively recently—1–5 million years ago
(Palmarini et al., 2000a). The existence of endogenous proviruses complicated
experiments, in that it was necessary to distinguish the endogenous proviruses
from the exogenous JSRV present in lung fluid. PCR-based assays were devel-
oped that allowed distinguishing exogenous from endogenous JSRV’s (Palmarini
et al., 1996). This allowed demonstration that tumor samples from OPA animals
consistently contain exogenous JSRV DNA above and beyond the endogenous
JSRV-related sequences. The JSRV cDNA clones were also used for production

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

DEFINING THE RELATIONSHIP 69

JSRV21

pro pol
env

orf-x
gag

FIGURE 1-12 Genetic organization of the genome of jaagsiekte sheep retrovirus.

NOTE: The acronyms and abbreviations in the diagram stand for genes that code for the
following: gag = viral packaging protein; pro = promoter; pol = polymerase; orf = open
reading frame; env = viral envelope protein.

of bacterial expression plasmids, for development of anti-JSRV antisera. A rabbit

polyclonal antibody to JSRV capsid (CA) has been particularly useful. Immuno-
histochemistry with this antiserum indicated that in OPA animals, the tumor cells
consistently show the presence of JSRV CA antigens, while normal cells of the
lung do not. In addition, lung cells from uninfected animals do not show JSRV
CA protein. These results further strengthened the likelihood that JSRV is the
causative agent of OPA.
A major goal was isolation of an infectious and oncogenic molecular clone
of JSRV. We undertook such experiments (Palmarini et al., 1999), taking advan-
tage of the prior work. Most notably, the availability of the complete JSRV se-
quence, and the PCR-based diagnosis for exogenous JSRV were important. A
lambda phage genomic library was prepared from a naturally occurring OPA
tumor from the United Kingdom. The library was screened by a combination of
sib-selection and PCR diagnosis for exogenous JSRV recombinants, followed by
standard filter hybridizations with JSRV-specific probes. One lambda phage re-
combinant was obtained that contained a complete JSRV provirus integrated into
adjacent cellular sequences, JSRV21. Sequencing of this clone revealed a genome
with very high (~95 percent) homology to the previously deduced South African
JSRV sequence. All of the open reading frames in the initial sequence deduced by
York et al. were present, and there were no other additional frames. Thus the
failure of previous attempts to obtain infectious virus from the assembled cDNA
clones did not reflect the absence of sequences in the partial cDNA clones. To
test whether the JSRV21 genome was infectious, we carried out in vivo DNA

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

70 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

transfections in newborn lambs. In vivo transfection of retroviral DNA was first

demonstrated for bovine leukemia virus (Willems et al., 1993). In vivo transfec-
tion of JSRV DNA was accomplished by incorporating a plasmid form of JSRV21,
pJS21, into liposomes containing a lipid that favors DNA transfer into lung epi-
thelial cells. The pJS21 liposomes were injected intratracheally into newborn
lambs, and PBMCs were tested for the presence of JSRV DNA at different times
post-transfection. Nested PCR amplifications revealed the presence of exogenous
JSRV DNA in PBMCs from the transfected animals at various times up to nine
months, when the animals were sacrificed. These results indicated that the JSRV21
was an infectious provirus. However, at necropsy (9 months), no tumors were
observed, so this experiment did not indicate if JSRV21 was an oncogenic clone.
The failure to observe tumors in the pJS21-transfected animals might have
been due to the relative inefficiency of in vivo DNA transfection. Therefore, a
method for generating genuine JSRV virus from the pJS21 clone was developed.
Ultimately, we were able to prepare significant amounts of JSRV virus from a
version of the pJS21 plasmid in which the human cytomegalovirus immediate
early promoter drives expression of the JSRV sequences. Transient transfection
of pJS21 into human 293T cells resulted in the production of JSRV particles.
When concentrated JSRV stocks prepared in this way were inoculated intra-
tracheally into four newborn lambs, two lambs developed classic OPA within
four months. The resulting tumors were positive for viral CA antigen and DNA
(Palmarini et al., 1999). This proved that JSRV is the causative agent of OPA.
The availability of an infectious and oncogenic molecular clone of JSRV has
opened up several avenues of research that are being pursued.
Two features of JSRV molecular biology are particularly noteworthy. First,
JSRV is unusual among retroviruses in that its expression is highly restricted in
vivo. In infected animals, JSRV DNA sequences can be detected in various cells,
including different lineages of hematopoietic cells in the PBMCs (Holland et al.,
1999). The level infection is low—detection requires a nested PCR—and this
infection is apparently not productive, since CA antigen-positive cells cannot be
detected in PBMCs. Even in lungs of animals with end-stage OPA, CA antigen is
only detected in the tumor cells. In particular, other lung cells (even normal lung
epithelial cells) do not typically express the CA antigen (Sharp and DeMartini,
2003). Thus, lung epithelial cells may be the only cell types in which JSRV infec-
tion is productive. The basis for the expression specificity is the enhancer se-
quences in the JSRV long terminal repeat (LTR). Retroviral LTRs containing
enhancer sequences in the U3 region that are responsible for driving transcription
of the provirus. We showed that the JSRV LTR is quite specific for lung epithe-
lial cells in transient transfection assays using a JSRV LTR-driven luciferase
reporter gene in mouse cell lines of different differentiation lineages (Palmarini et
al., 2000b). Deletional analysis indicated that the JSRV enhancers function in
lung epithelial-derived cell lines, while they are inactive in most other cell types.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

DEFINING THE RELATIONSHIP 71

DNA
FIGURE 1-13 Foci of transformation induced by the transfection of clone JSRV DNA
into mouse NIH 3T3 cells. Such transfection is a standard assay for detecting viral and
cellular oncogenes. Panels (a) and (c) show untransfected NIH3T3 cells. Panel (b) shows
a focus of transformed cells resulting from transfection with CMV-driven plasmid DNA
(pCMV2JS21). Panel (d) shows a pCMV2JS21 transfected culture that had been passaged
several times prior to plating under focus-forming conditions.

Detailed analysis of the factors responsible for the lung epithelial-specific

expression is in progress.
The second interesting feature of JSRV biology is that the viral genome ap-
pears to contain a transforming gene. In fact, JSRV is an extremely potent car-
cinogen in the laboratory setting. Experimentally inoculated newborn animals
develop end-stage OPA with a mean time of six weeks, and in some cases tumors
have been observed as early as 10 to 14 days. The rapid oncogenesis, coupled
with the multi-focal pattern of the tumors is consistent with a direct transforming
function (oncogene) in the virus. We showed that transfection of clone JSRV
DNA into mouse NIH 3T3 cells could induce foci of transformation, a standard
assay for detection of viral and cellular oncogenes (see Figure 1-13) (Maeda et
al., 2001). Further studies indicated that the envelope gene of JSRV is responsible
for the transformation. Transformation appears to occur through the cytoplasmic
tail of the envelope transmembrane (TM) protein (Palmarini et al., 2001a). The
cytoplasmic tail contains a docking site for PI 3 kinase, an important cellular
kinase involved in signal transduction and oncogenic transformation. Mutation of
the critical tyrosine for methionine residues in the PI3K docking site led to loss of
transformation. It is noteworthy that all exogenous JSRV envelopes sequenced so
far contain the PI3K binding domain, while endogenous JSRV-related envelope
genes do not.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

72 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

The finding that the JSRV envelope gene contains oncogenic potential is
unusual for replication-competent retroviruses. Most other replication-competent
retroviruses do not normally cause tumors by a direct mechanism (i.e.,
oncogenes). More typically, oncogenesis is a byproduct of the replication cycle
(e.g., insertional activation of cellular proto-oncogenes). However, the fact that
all exogenous JSRVs have a transforming envelope suggests that this property is
important for replication of the virus. We have proposed a hypothesis to explain
this. In studies of the endogenous JSRV-related proviruses, we found that the
endogenous JSRV LTRs do not show transcriptional specificity for lung epithe-
lial cells (Palmarini et al., 2000a). The endogenous viruses provide a view into
the primordial progenitor of JSRV, since they reflect the JSRV progenitor from 1
million to 5 million years ago. (Mutation rates of retroviral DNAs decrease mark-
edly when they are transmitted in the proviral [DNA] form.) Thus the progenitor
to exogenous JSRV likely replicated through different cells in the animals than
lung epithelial cells. Indeed, the endogenous JSRV proviruses in current day sheep
are not expressed in lung epithelial cells, but they are expressed in cells of the
female reproductive tract (Palmarini et al., 2001b). During evolution of exog-
enous JSRV, presumably alterations in the enhancer sequences in the LTR arose
that conferred transcriptional specificity for lung epithelial cells. However, in the
normal adult lung there is relatively little division and growth of Type II
pneumocytes and close cells. Most retroviruses require cell division for efficient
infection and production. Thus during evolution of exogenous JSRV, the muta-
tion in the cytoplasmic tail of the envelope TM protein would allow for more
efficient infection and expression in lung epithelial cells, to which JSRV is tran-
scriptionally restricted.
As mentioned above, JSRV-induced OPA is histologically very similar to
human adenocarcinoma and BAC. In light of the lack of association of human
BAC with tobacco smoking and its increasing incidence, the possibility of a viral
involvement in human lung adenocarcinoma has also been raised. Several inves-
tigators have specifically explored whether a human virus related to JSRV might
be associated with human lung cancer. In particular, De las Heras and colleagues
recently reported a study in which they screened a series of human lung cancers
and other tumors for immunological staining with a polyclonal antibody to JSRV
CA protein (De las Heras et al., 2000). They found that approximately 30 percent
of human BACs and nearly 25 percent of human lung adenocarcinomas showed
immunohistochemical staining with the JSRV CA antibody. In contrast, little or
no reactivity was detected in squamous cell carcinomas of the lung and other
tumors. Thus the reactivity appears to be rather specific for human lung adeno-
carcinomas and BACs. Another laboratory has been able to replicate these immu-
nohistochemistry findings (J. DeMartini, personal communication). On the other
hand, several investigators have attempted to clone a JSRV-related retrovirus
from these human tumors by using PCR amplification with degenerative oligo-
nucleotide primers. So far no one has succeeded.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

DEFINING THE RELATIONSHIP 73

The antigenic cross-reactivity to JSRV observed in some human lung adeno-

carcinomas might result from two possibilities. First, it could reflect infection
with an exogenous human retrovirus with some relationship to JSRV. Alterna-
tively, it could reflect expression of a human endogenous retrovirus (HERV) with
antigenic cross-reactivity to JSRV. The human genome contains many copies of
HERVs, divided into several classes. It has been shown that different HERVs are
expressed in normal versus malignant tissues. It has been noted that the JSRV
sequence has some similarity to the HERV-K class, so it is possible that these
tumors are expressing a HERV-K (J. DeMartini, personal communication). A
third possibility is that the antigenic cross-reactivity could reflect a human cellu-
lar protein unrelated to a retrovirus. Identification of the nucleic acid encoding
the JSRV antigenic cross-reactivity in the human lung adenocarcinomas and
BACs is a goal of primary importance, and several laboratories are actively pur-
suing this. Once the genetic material encoding the cross-reactivity is identified, if
it corresponds to an exogenous or endogenous human retrovirus, the next impor-
tant issue will be to ascertain whether it has a causal role in lung carcinogenesis.
For such experiments, the JSRV OPA system and sheep will provide a valuable
framework for designing experiments to address this question.

REFERENCES
De las Heras M, Barsky SH, Hasleton P, Wagner M, Larson E, Egan J, Ortin A, Gimenez-Mas JA,
Palmarini M, Sharp JM. 2000. Evidence for a protein related immunologically to the jaagsiekte
sheep retrovirus in some human lung tumors. The European Respiratory Journal 15:330–332.
DeMartini J, Carlson J, Leroux C, Spencer T, Palmarini M. 2003. Endogenous retroviruses related to
jaagsiekte sheep retrovirus. Pp. 117–137 in Jaagsiekte Sheep Retrovirus and Lung Cancer, H
Fan, ed. Berlin: Springer-Verlag.
Fan H, ed. 2003. Jaagsiekte Sheep Retrovirus and Lung Cancer, Vol. 275. Berlin: Springer-Verlag.
Hecht SJ, Stedman KE, Carlson JO, DeMartini JC. 1996. Distribution of endogenous type B and type
D sheep retrovirus sequences in ungulates and other mammals. Proceedings of the National
Academy of Sciences 93:3297–3302.
Holland MJ, Palmarini M, Garcia-Goti M, Gonzalez L, de las Heras M, McKendrick I, Sharp JM.
1999. Jaagsiekte retrovirus is widely distributed both in T and B lymphocytes and in mono-
nuclear phagocytes of sheep with naturally and experimentally acquired pulmonary adenomato-
sis. Journal of Virology 73:4004–4008.
Jackson LA, Wang SP, Nazar-Stewart V, Grayston JT, Vaughan TL. 2000. Association of Chlamydia
pneumoniae immunoglobulin A seropositivity and risk of lung cancer. Cancer Epidemiology
Biomarkers and Prevention 9:1263–1266.
Koyi H, Branden E, Gnarpe J, Gnarpe H, Steen B. 2001. An association between chronic infection
with Chlamydia pneumoniae and lung cancer. A prospective 2-year study. APMIS 109:572–
580.
Laurila AL, Anttila T, Laara E, Bloigu A, Virtamo J, Albanes D, Leinonen M, Saikku P. 1997.
Serological evidence of an association between Chlamydia pneumoniae infection and lung can-
cer. International Journal of Cancer 74:31–34.
Maeda N, Palmarini M, Murgia C, Fan H. 2001. Direct transformation of rodent fibroblasts by
jaasiekte sheep retrovirus DNA. Proceedings of the National Academy of Sciences 98:4449–
4454.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

74 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

Mornex JF, Thivolet F, de las Heras M, Leroux C. 2003. Pathology of human bronchioloalveolar
carcinoma and its relationship to the ovine disease. Pp. 225–248. In Fan H, editor. Jaagsiekte
Sheep Retrovirus and Lung Cancer. Berlin: Springer-Verlag.
Palmarini M, Cousens C, Dalziel RG, Bai J, Stedman K, DeMartini JC, Sharp JM. 1996. The exog-
enous form of Jaagsiekte retrovirus is specifically associated with a contagious lung cancer of
sheep. Journal of Virology 70:1618–1623.
Palmarini M, Sharp JM, de las Heras M, Fan H. 1999. Jaagsiekte sheep retrovirus is necessary and
sufficient to induce a contagious lung cancer in sheep. Journal of Virology 73:6964–6972.
Palmarini M, Hallwirth C, York D, Murgia C, de Oliveira T, Spencer T, Fan H. 2000a. Molecular
cloning and functional analysis of three type D endogenous retroviruses of sheep reveal a differ-
ent cell tropism from that of the highly related exogenous jaagsiekte sheep retrovirus. Journal of
Virology 74:8065–8076.
Palmarini M, Datta S, Omid R, Murgia C, Fan H. 2000b. The long terminal repeat of Jaagsiekte sheep
retrovirus is preferentially active in differentiated epithelial cells of the lungs. Journal of Virol-
ogy 74:5776–5787.
Palmarini M, Maeda N, Murgia C, De-Fraja C, Hofacre A, Fan H. 2001a. A phosphatidylinositol 3-
kinase docking site in the cytoplasmic tail of the jaagsiekte sheep retrovirus transmembrane
protein is essential for envelope-induced transformation of NIH 3T3 cells. Journal of Virology
75:11002–11009.
Palmarini M, Gray CA, Carpenter K, Fan H, Bazer FW, Spencer TE. 2001b. Expression of endog-
enous betaretroviruses in the ovine uterus: effects of neonatal age, estrous cycle, pregnancy and
progersterone. Journal of Virology 75:11319–11327.
Sharp J and DeMartini J. 2003. Natural history of JSRV in sheep. Pp. 55–79. In Fan H, editor.
Jaagsiekte Sheep Retrovirus and Lung Cancer. Berlin: Springer-Verlag.
Sharp JM and Herring AJ. 1983. Sheep pulmonary adenomatosis: demonstration of a protein which
cross-reacts with the major core proteins of Mason-Pfizer monkey virus and mouse mammary
tumour virus. The Journal of General Virology 64:2323–2327.
Willems L, Kettmann R, Dequiedt F, Portetelle D, Voneche V, Cornil I, Kerkhofs P, Burny A,
Mammerickx M. 1993. In vivo infection of sheep by bovine leukemia virus mutants. Journal of
Virology 67:4078–4085.
York D and Querat G. 2003. A history of ovine pulmonary adenocarcinoma (Jaagsiekte) and experi-
ments leading to the deduction of the JSRV nucleotide sequence. Pp. 1–23. In Fan H, editor.
Jaagsiekte Sheep Retrovirus and Lung Cancer. Berlin: Springer-Verlag.
York DF, Vigne R, Verwoerd DW, Querat G. 1991. Isolation, identification, and partial cDNA clon-
ing of genomic RNA of jaagsiekte retrovirus, the etiological agent of sheep pulmonary ad-
enomatosis. Journal of Virology 65:5061–5067.
York DF, Vigne R, Verwoerd DW, Querat G. 1992. Nucleotide sequence of the jaagsiekte retrovirus,
an exogenous and endogenous type D and B retrovirus of sheep and goats. Journal of Virology
66:4930–4939.

PROPIONIBACTERIUM ACNES AND CHRONIC DISEASES

Ajay Bhatia, Ph.D.; Jean-Francoise Maisonneuve, Ph.D.; and
David H. Persing, M.D., Ph.D.
Corixa Corporation, Seattle, WA

Propionibacterium acnes is a gram-positive human skin commensal that pre-

fers anaerobic growth conditions and is involved in the pathogenesis of acne
(Kirschbaum and Kligman, 1963). Acne is one of the most common skin dis-
eases, affecting more than 45 million individuals in the United States. It is esti-

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

DEFINING THE RELATIONSHIP 75

mated that nearly 20 percent of all visits to dermatologists are related to the treat-
ment of acne. Acne often debuts during changes in hormonal levels in pre-teens;
however, it is also very common as an adult-onset condition, often associated
with hormonal fluctuation during the menstrual cycle and pregnancy. While not
life-threatening, acne can persist for years and is known to have serious psycho-
social effects such as decreased self-esteem, depression, frustration, and social
withdrawal. In addition to dermatological pathology, P. acnes is also suspected to
be discreetly involved in post-operative infections, prostheses failure, and more
recently, in inflammation of lumbar nerve roots leading to sciatica.
P. acnes, previously known by the name Corynebacterium parvum, has been
studied extensively by immunologists for its ability to stimulate the reticuloen-
dothelial system (Adlam and Scott, 1973). Not too long ago, an important
cytokine, interleukin (IL)-18 was cloned from the liver of mice primed with P.
acnes followed by challenge with LPS (Okamura et al., 1995). In the early eight-
ies, certain bacteria, including BCG and P. acnes, were commonly used to stimu-
late the innate immune response against cancer in mice and human cells (Cantrell
and Wheat, 1979; Davies, 1982). One of the great ironies of this organism is that
it is a powerful nonspecific immune stimulant that resides naturally in the skin;
its role as an immunostimulant in humans is appreciated when cases of severe
acne also develop adjuvant-type arthritis.
Some investigators have gone so far as to suggest that severe acne, by virtue
of the nonspecific immunostimulatory effects of P. acnes, might have played a
role in natural protection against life-threatening diseases such as malaria and
plague. In contrast, the acquired immune response to P. acnes has received little
attention in humans.

Pathogenesis of Acne
Chronic inflammatory acne cannot be defined as an infectious disease, since
the bacteria are normally present on the skin of a vast majority of individuals,
irrespective of the presence of acne lesions. P. acnes apparently only triggers the
disease when it meets favorable dermatophysiological terrain; P. acnes coloniza-
tion of the skin is therefore necessary but not sufficient for the establishment of
the pathology. The 4 major recognized pathophysiological features of acne in-
clude androgen stimulated seborrhea, hyperkeratinization and obstruction of the
follicular epithelium, proliferation of P. acnes, and then inflammation.
Comedogenesis, the transformation of the pilosebaceous follicle into the pri-
mary acne lesion, the comedone, is the product of abnormal follicular keratiniza-
tion related to excessive sebum secretion. During this process, P. acnes often gets
trapped in layers of corneocytes and sebum and rapidly colonizes the comedonal
kernel, resulting in a microcomedone, a structure invisible to the naked eye
(Plewig and Kligman, 2000). A microcomedone can develop into larger struc-
tures, called comedones. Comedones can be a closed structure (whitehead) that

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

76 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

appears like a colored bump on the skin or an open structure (blackhead). Unlike
open comedones, closed comedones cannot evacuate the thread-looking conglom-
erate of cell debris, sebum, P. acnes and its products to the skin surface, and this
makes them more prone to inflammation and rupture. In inflammatory acne,
comedones rupture and the follicular material becomes dispersed in the dermis
rather than on the skin surface. Depending on the extent of the damage to the
comedone wall, various types of inflammatory lesions are produced and these are
classified as papules, pustules, or nodules. Nodules are the most severe types of
acne lesions and scarring may be associated with any form of severe inflamma-
tory acne.
A break in the lining of the comedone was initially attributed to free fatty
acids generated by P. acnes-mediated triglyceride hydrolysis, but for several rea-
sons, it is now thought that substances produced by P. acnes are directly involved
in the rupture the comedone epithelial lining (Holland et al., 1981). The bacteria
secrete many polypeptides, among which are numerous extracellular enzymes
such as proteases, hyaluronidases, neuraminidases, and others that could be in-
volved in epithelium permeabilization and inflammatory infiltration (Noble,
1984). P. acnes is also known to produce chemotactic factors (Puhvel and
Sakamoto, 1977), proinflammatory cytokine inducing-factors (Vowels et al.,
1995), and to activate both the direct and indirect complement pathways (Webster
et al., 1978). The infiltrate of an early inflamed lesion consists of polymorpho-
nuclear cells that certainly contribute to the lining breakage, but eventually, as
time goes by and infection becomes chronic, these cells attract and are replaced
by mononuclear cells, predominantly T-cells of the CD4 phenotype (Norris and
Cunliffe, 1988; Layton et al., 1994). As the inflammation propagates to the lining
of adjacent sebaceous follicules, it can start a chain reaction that results in mul-
tiple lesions connected together and called a sinus. Studies by Hoffler et al. (1985)
have revealed differences in the production of various enzymes by Propionibac-
terium isolates of acne lesions versus bacteria isolated from healthy controls.
These studies are important for differentiating bacterial antigens that lead healthy
controls to generate a protective immune response and those that might be in-
volved in pathogenesis.
Antibody against P. acnes antigenic determinants are found in the blood of
most adults, whether they have had acne or not (Ingham et al., 1987); amounts
may vary between the two populations, and possibly the nature of the determi-
nants the antibodies recognize (Holland et al., 1993). Recent investigations by
our group suggest that differential recognition might involve surface molecules
with physiological functions. P. acnes specific IgG and IgA are also found at the
level of the follicular infudibulum (Knop et al., 1983); these antibodies might be
of great importance in limiting or preventing P. acnes proliferation, and maybe
more importantly, in preventing comedonal lining destruction by P. acnes-de-
rived soluble factors. Our preliminary data suggests that a robust P. acnes spe-
cific T-cell response is also common in adult donors, but its specificity at the

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

DEFINING THE RELATIONSHIP 77

antigen level is currently under investigation. We like to think that there possibly
exists a P. acnes-specific protective immunity against acne. This hypothesis is
supported by the fact that some people never get acne, as well as by the observa-
tion that acne is mostly a disease of young people, (although there are numerous
exceptions), and that even in countries where people are unable to afford sophis-
ticated medications, chronic disease of adolescents eventually resolves with age.
Finally, there have been successful human trials of therapeutic vaccination against
P. acnes, and although the rate of success has not been high, some individuals
refractory to conventional approaches experienced remission (Goldman et al.,
1979; Vymola et al., 1970).

Role of P. acnes in Chronic Inflammation and Systemic Infections

The chronic inflammatory condition of the pilosebaceous follicle caused by
P. acnes is generally considered non-pathogenic. However, there is a growing
body of evidence that point to the bacterium as being low virulence pathogen in
several types of postoperative infections and other chronic conditions. P. acnes
have been associated with endocarditis of prosthetic (Lazar and Schulman, 1992)
and native aortic valves (Mohsen et al., 2001), corneal infections (Underdahl et
al., 2000) and postoperative endophthalmitis (Clark et al., 1999). It has also been
recognized as a source of infection in focal intracranial infections (Chu et al.,
2001) and various cerebrospinal fluid shunt infections (Thompson and Albright,
1998).
A recent study from Japan (Ishige et al., 1999) has shown that P. acnes DNA
can be detected in lymph nodes of Japanese individuals with sarcoidosis. Sarcoi-
dosis is a granulomatous disease that results in the inflammation of lymph nodes,
lungs, eyes, liver, and other tissues. P. acnes have also been implicated in sci-
atica, a chronic inflammatory condition of the lower back. Stirling et al. (2001)
have isolated P. acnes from intervertebral disc material of patients with severe
sciatica and they hypothesize that low virulent organisms such as P. acnes can
gain access to the injured spinal disc and initiate chronic inflammation. However,
until confirmatory data is available, the proposed role of P. acnes in sarcoidosis
and sciatica should be considered intriguing but preliminary.
It also appears to be significant that P. acnes have been isolated from several
orthopedic infections, silicone breast prosthesis, and prosthetic joint infections
(Yu et al., 1997; Tunney et al., 1999). The infected prostheses have been shown
to contain bacterial biofilms of P. acnes and/or Staphylococcus epidermidis. The
adhesion of P. acnes to the surface of the prostheses has been postulated to be a
result of binding of propionibacterial cell surface proteins or adhesion molecules
to host plasma or connective tissue proteins such as fibronectin (Yu et al., 1997).
Evidence for this hypothesis comes from the studies of Herrmann et al. (1988),
who show that fibronectin, fibrinogen, and laminin are mediators of adherence of
staphylococcal isolates to polymer surfaces in intravenous device infection.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

78 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

Corixa Acne Vaccine Program

The gamut of acne treatments range from topical and systemic antibiotics to
oral and topical isotretinoins, chemicals like benzoyl peroxide, oral contracep-
tives and corticosteroids. Antibiotics have been in use for several decades as one
of the most common treatments for acne. Antibiotics, both topical and systemic,
take a relatively long time to reduce the numbers of P. acnes bacteria in the skin
and do not address other causative factors of acne. More recently, vitamin A
derivatives called retinoids have been used effectively for acne treatment since
these drugs help unclog pores, reduce sebum production and help normalize skin
shedding and growth. However, oral isotretinoins are also known to cause severe
side effects including elevated serum triglyceride levels, acute pancreatitis, hepa-
totoxicity, clinical depression, and birth defects in pregnant women.
To help identify components of P. acnes involved in pathogenesis or a pro-
tective immune response and develop a therapeutic vaccine for acne, we recently
sequenced the genome of P. acnes. The genome is approximately 2.6 Mb and
organized into 100 contigs. It shares similarity with the genomes of other bacte-
ria, including Streptomyces coelicor, Mycobacterium tuberculosis, and other
gram-positive cocci. Numerous homologues to virulence factors of other gram-
positive pathogens have been found in the P. acnes genome, including homo-
logues of known vaccine targets.
Whole genome sequencing of microbial pathogens has been used success-
fully to predict vaccine candidates in Streptococcus pneumoniae and Haemophilus
influenzae (Adamou et al., 2001; Wizemann et al., 2001; Chakravarti et al., 2000).
We are using a multifaceted approach that combines traditional immunological
and biochemical antigen discovery strategies along with a genomics approach to
identify antigens for use as vaccine targets. This approach includes serological
expression cloning, proteomics, and CD4 T-cell expression cloning. We are fur-
ther enhancing antigen discovery methods by using in-silico approaches to pre-
dict targets for antibody-based vaccines and antimicrobial agents. The products
of these various research strategies provide attractive antigen candidates, i.e., a
polypeptide that is detected by serum from adult individuals who never suffered
acne, and predicted to be extracellular and involved in P. acnes metabolism, or an
immunogenic extracellular enzyme potentially involved in epithelial destruction.
Such antigens may prove to be valuable vaccine candidates for the other chronic
diseases associated with P. acnes as well.
Knowing the physiological function of our targets allows us to tailor in-vitro
and in-vivo assays to evaluate the potential of specific immune components to
limit or abolish the events that lead to inflammatory acne. Since the antigens of
choice will be delivered under a recombinant protein format, they will require a
strong adjuvant that induces an adequate immune response at the correct site.
Recent data indicates that Corixa’s proprietary adjuvants, MPL® and AGPs
(aminoalkyl glucosaminide phosphates), induce strong mucosal and systemic

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

DEFINING THE RELATIONSHIP 79

immunity when administered mucosally. Adjuvants such as these would be use-

ful to prime a local immune system against P. acnes at the pilosebaceous level.
Lastly, the molecules discovered by immunological methods could be used
in immunodiagnostic assays. For example, we might be able to develop serologi-
cal markers to predict in early adolescence the likelihood of future acne flares. In
addition, since many of the studies of the involvement of P. acnes outside of the
skin have so far relied on culture-based and molecular techniques that are prone
to false positive results, future studies of disease associations of P. acnes might
be facilitated by the availability of a specific immunoassay comprising recombi-
nant P. acnes proteins.

REFERENCES
Adamou JE, Heinrichs JH, Erwin AL, Walsh W, Gayle T, Dormitzer M, Dagan R, Brewah YA,
Barren P, Lathigra R, Langermann S, Koenig S, Johnson S. 2001. Identification and character-
ization of a novel family of pneumococcal proteins that are protective against sepsis. Infection
and Immunity 69:949–958.
Adlam C and Scott MT. 1973. Lympho-reticular stimulatory properties of Corynebacterium parvum
and related bacteria. Journal of Medical Microbiology 6:261–274.
Cantrell JL and Wheat RW. 1979. Antitumor activity and lymphoreticular stimulation properties of
fractions isolated from Corynebacterium parvum. Cancer Research 39:3554–3563.
Chakravarti DN, Fiske MJ, Fletcher LD, Zagursky RJ. 2000. Application of genomics and proteomics
for identification of bacterial gene products as potential vaccine candidates. Vaccine 19:601–
612.
Chu RM, Tummala RP, Hall WA. 2001. Focal intracranial infections due to Propionibacterium acnes:
report of three cases. Neurosurgery 49:717–720.
Clark WL, Kaiser PK, Flynn HW Jr, Belfort A, Miller D, Meisler DM. 1999. Treatment strategies and
visual acuity outcomes in chronic postoperative Propionibacterium acnes endophthalmitis. Oph-
thalmology 106:1665–1670.
Davies M. 1982. Bacterial cells as anti-tumour agents in man. Reviews on Environmental Health
4:31–56.
Goldman L, Michael JG, Riebel S. 1979. The immunobiology of acne. A polyvalent proprionibacteria
vaccine. Cutis 23:181–184.
Herrmann M, Vaudaux PE, Pittet D, Auckenthaler R, Lew PD, Schumacher-Perdreau F, Peters G,
Waldvogel FA. 1988. Fibronectin, fibrinogen, and laminin act as mediators of adherence of
clinical staphylococcal isolates to foreign material. The Journal of Infectious Diseases 158:693–
701.
Hoffler U, Gehse M, Gloor M, Pulverer G. 1985. Enzyme production of propionibacteria from pa-
tients with acne vulgaris and healthy persons. Acta Dermato-Venereologica 65:428–432.
Holland KT, Ingham E, Cunliffe WJ. 1981. A review, the microbiology of acne. The Journal of
Applied Bacteriology 51:195–215.
Holland KT, Holland DB, Cunliffe WJ, Cutcliffe AG. 1993. Detection of Propionibacterium acnes
polypeptides which have stimulated an immune response in acne patients but not in normal
individuals. Experimental Dermatology 2:12–16.
Ingham E, Gowland G, Ward RM, Holland KT, Cunliffe WJ. 1987. Antibodies to P. acnes and P.
acnes exocellular enzymes in the normal population at various ages and in patients with acne
vulgaris. The British Journal of Dermatology 116:805–812.
Ishige I, Usui Y, Takemura T, Eishi Y. 1999. Quantitative PCR of mycobacterial and propionibacterial
DNA in lymph nodes of Japanese patients with sarcoidosis. Lancet 354:120–123.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

80 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

Kirschbaum JO and Kligman AM. 1963. The pathogenic role of Corynebacterium acnes in acne
vulgaris. Archives of Dermatology 88:832–833.
Knop J, Ollefs K, Frosch PJ. 1983. Anti-P. acnes antibody in comedonal extracts. The Journal of
Investigative Dermatology 80:9–12.
Layton AM, Henderson CA, Cunliffe WJ. 1994. A clinical evaluation of acne scarring and its inci-
dence. Clinical and Experimental Dermatology 19:303–308.
Lazar JM and Schulman DS. 1992. Propionibacterium acnes prosthetic valve endocarditis: a case of
severe aortic insufficiency. Clinical Cardiology 15:299–300.
Mohsen AH, Price A, Ridgway E, West JN, Green S, McKendrick MW. 2001. Propionibacterium
acnes endocarditis in a native valve complicated by intraventricular abscess: a case report and
review. Scandinavian Journal of Infectious Diseases 33:379–380.
Noble WC. 1984. Skin microbiology: coming of age. Journal of Medical Microbiology 17:1–12
Norris JF and Cunliffe WJ. 1988. A histological and immunocytochemical study of early acne le-
sions. The British Journal of Dermatology 118:651–659.
Okamura H, Nagata K, Komatsu T, Tanimoto T, Nukata Y, Tanabe F, Akita K, Torigoe K, Okura T,
Fukuda S. 1995. A novel costimulatory factor for gamma interferon induction found in the livers
of mice causes endotoxic shock. Infection and Immunity 63:3966–3972.
Plewig G and Kligman AM, eds. 2000. Acne and Rosacea, 3rd ed., 744 pages. New York: Springer-
Verlag.
Puhvel SM and Sakamoto M. 1977. Chemoattractant properties of Corynebacterium parvum and
pyran copolymer for human monocytes and neutrophils. Journal of the National Cancer Insti-
tute 58:781–783.
Stirling A, Worthington T, Rafiq M, Lambert PA, Elliott TS. 2001. Association between sciatica and
Propionibacterium acnes. Lancet 357:2024–2025.
Thompson TP and Albright AL. 1998. Propionibacterium [correction of Proprionibacterium] acnes
infections of cerebrospinal fluid shunts. Childs Nervous System 14:378–380.
Tunney MM, Patrick S, Curran MD, Ramage G, Hanna D, Nixon JR, Gorman SP, Davis RI, Ander-
son N. 1999. Detection of prosthetic hip infection at revision arthroplasty by immunofluores-
cence microscopy and PCR amplification of the bacterial 16S rRNA gene. Journal of Clinical
Microbiology 37:3281–3290.
Underdahl JP, Florakis GJ, Braunstein RE, Johnson DA, Cheung P, Briggs J, Meisler DM. 2000.
Propionibacterium acnes as a cause of visually significant corneal ulcers. Cornea 19:451–454.
Vymola F, Buda J, Lochmann O, Pillich J. 1970. Successful treatment of acne by immunotherapy.
Journal of Hygiene, Epidemiology, Microbiology, and Immunology 14:135–138.
Vowels BR, Yang S, Leyden JJ. 1995. Induction of proinflammatory cytokines by a soluble factor of
Propionibacterium acnes: implications for chronic inflammatory acne. Infection and Immunity
63:3158–3165.
Webster GF, Leyden JJ, Norman ME, Nilsson UR. 1978. Complement activation in acne vulgaris: in
vitro studies with Propionibacterium acnes and Propionibacterium granulosum. Infection and
Immunity 22:523–529.
Wizemann TM, Heinrichs JH, Adamou JE, Erwin AL, Kunsch C, Choi GH, Barash SC, Rosen CA,
Masure HR, Tuomanen E, Gayle A, Brewah YA, Walsh W, Barren P, Lathigra R, Hanson M,
Langermann S, Johnson S, Koenig S. 2001. Use of a whole genome approach to identify vaccine
molecules affording protection against Streptococcus pneumoniae infection. Infection and Im-
munity 69:1593–1598.
Yu JL, Mansson R, Flock JI, Ljungh A. 1997. Fibronectin binding by Propionibacterium acnes. FEMS
Immunology and Medical Microbiology 19:247–253.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

Endemic Infectious Diseases

Linked to Chronic Diseases:
Implications for Developing Countries

OVERVIEW
Successful disease control efforts in some economically developing coun-
tries have increased life expectancy and resulted in changes in demographics from
predominantly youthful populations to older and aging ones. Consequently, dur-
ing the next 20 years, chronic diseases are expected to become increasingly im-
portant in economically developing regions and to encompass chronic conditions
currently attributed to industrialized nations. Not only will changing economics,
demographic shifts with lower childhood mortality, and changing lifestyles affect
this trend, but migration from rural to urban areas and into previously uninhabited
ecosystems may expose populations to new infectious agents that underlie chronic
disease. Both newly identified and well-recognized infectious etiologies of
chronic disease, including infections known to enter a chronic state, such as tu-
berculosis and malaria, will acquire increasing importance to domestic and global
health. As such, countries with limited research capacities and health care ser-
vices will face increasing burdens from both infectious and chronic disease.
Richard Guerrant illustrated the wide-ranging nature of the threats from
chronic diseases caused by infections, using as an example the long-term conse-
quences of early childhood enteric and parasitic infections. The chronic impact of
repeated malnourishing diarrheal illnesses is greater than that of acute deaths
from enteric illness, which claims more than 6,000 children each day. Early diar-
rheal illnesses have significant long-term effects not only on physical fitness, but
on growth, cognition, and school performance. Diarrhea appears to be a cofactor
with malnutrition in that it reduces nutritional absorption.

81

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

82 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

Josemir Sander detailed the relationship between epilepsy, the most common
serious neurological condition worldwide, and a number of parasites. Epilepsy is
a symptom complex, so diagnosis relies on clinical history rather than a specific
test. Incidence is higher in developing countries than in the industrialized world,
and appears to be higher in rural areas than in urban areas. Furthermore, endemic
infections may be responsible for the increased incidence in low-income coun-
tries.
Maureen Durkin discussed ostensibly preventable or controllable infections
that are important causes of childhood cognitive disability, paralysis, epilepsy,
blindness, and deafness in developing countries. These infections include con-
genital disorders, such as syphilis, rubella, and cytomegalovirus, as well as infec-
tions occurring during infancy and childhood, such as malaria, meningitis, Japa-
nese viral encephalitis, measles, poliomyelitis, and trachoma.
Eduardo Gotuzzo described clinical experience with HTLV-1, a retrovirus
that causes adult T-cell leukemia and is endemic in much of Latin America.The
virus produces 3 different clinical patterns: cancer, autoimmune disease, and im-
munosuppression disease. In developing countries, 80 percent of lymphomas are
non-Hodgkins lymphoma, and 10 pecent of the non-Hodgkins lymphomas seen
by the Peruvian national cancer center are associated with HTLV-1. A second
clinical presentation is tropical dysplastic paraparesia (TSP). The third clinical
pattern associated with the infection is immunosuppression.
Sanaa Kamal described chronic hepatitis C infection with and without schis-
tosomiasis. Patients typically present in their thirties or forties with gastro-
intestinal bleeding, usually massive, and compromised liver function and status.
These patients progress rapidly to end stage disease, usually dying in their forties.
Coinfected individuals have significantly higher fibrosis levels and are unable to
achieve spontaneous viral clearance.
Altaf Lal described interactions between the human immunodeficiency virus
(HIV) and malaria to illustrate how different pathogens interact with each other
and how they modulate the disease process. Infant mortality is higher in babies
born to mothers who are infected with placental malaria and HIV-1, and these
infants have lower levels of acquired passive immunity. Concurrent infections
also promote pathogen diversity. The interactions, however, are extremely com-
plex. For example, acute measles suppresses HIV replication significantly.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

IMPLICATIONS FOR DEVELOPING COUNTRIES 83

POTENTIAL LONG-TERM CONSEQUENCES OF EARLY

CHILDHOOD ENTERIC AND PARASITIC INFECTIONS*
Richard L. Guerrant, M.D.; Aldo A.M. Lima, M.D., Ph.D.; Sean R. Moore,
M.S.; Breyette Lorntz, M.S.; and Peter Patrick, Ph.D.
Center for Global Health, University of Virginia School of Medicine; and
Federal University of Ceara, Fortaleza, Brazil

The assessment of the global burden of diseases is increasingly important in

recognizing and analyzing their importance as well as the priority of economic
investments in their amelioration. In this perspective we recognize the quality of
life or years lived with varying degrees of disability in addition to the quantity of
life lost to premature mortality, as important outcomes or consequences of all
diseases or conditions. Recognizing disability or quality of life is especially im-
portant, as mortality from a growing list of acute diseases is reduced, and chronic
diseases or long-term consequences of diseases or conditions are now being ap-
preciated. Only such a global view can begin to capture the full human and eco-
nomic costs of diseases, injuries, or other conditions. Only as these true costs are
appreciated, can we affect the necessary investments in their alleviation (Guerrant,
2001; Guerrant and Blackwood, 1999).

Importance of Measuring Morbidity as well as Mortality

Major advances have been made in understanding the quality and quantity
elements of health outcomes and the global burdens of disease. Two of these
“quality of life” measures are Quality-Adjusted Life Years (QALYs) and Disabil-
ity-Adjusted Life Years (DALYs). QALYs have been devised by economists to
capture both quality and quantity elements of a health care outcome in a single
measure, and have been used primarily in assessing the effectiveness of specific
interventions to improve health. However, QALYs suffer problems of subjective
value assignments that vary considerably with who makes the choices, and they
do not capture wider benefits (externalities) that may accrue to society, family, or
friends.
DALYs involve not only calculating age-specific mortality (as years of po-
tential life lost [YPLL] to fatal conditions) but also taking into account the quality
of life affected by disabilities (by formulating years lost to disability [YLD] with
nonfatal conditions, injuries, and diseases) (Murray et al., 1994; Murray and
Lopez, 1997). In calculating DALYs, perfect health is weighted as 0 disability
with disability weights progressing to 1, the equivalent of death. DALYs have the

*Parts of this paper have been published in a perspective article (Guerrant et al, 2002a) and in a
review (Guerrant et al., 2002b).

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

84 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

advantages that they can also help assess effectiveness of interventions as well as
the burden of disease and are standardized to permit age weighting and compara-
bility across studies.
All conditions affecting health as well as interventions that prevent or re-
verse the adverse effects of these conditions are measured in economic as well as
human terms. These include, in addition to the causes of death and the YPLL due
to premature mortality, the morbidity costs or YLD from conditions that impair
the ability of individuals to reach their full human and economic potential or
productivity. As causes of premature mortality are brought under control world-
wide, the morbidity costs are becoming increasingly recognized and their
quantitation is increasingly important. Thus, in addition to diseases or conditions
like meningitis, AIDS, or automobile accidents that are often fatal at young ages
and are thus responsible for disproportionately greater years of life lost, we must
also weigh the burden of chronic diseases, like arthritis or depression, that often
disable much more than they kill. Both YPLL and YLD are included in the
DALYs that are being used to assess the burdens of all diseases or conditions that
threaten healthy life worldwide, as well as the “cost-effectiveness” of interven-
tions designed for their amelioration. Both mortality (YPLL) and morbidity
(YLD) pose profound economic costs, whether a young, productive working par-
ent dies with AIDS or violence, or whether a child with repeated bouts of diar-
rhea, parasitic infection, or malnutrition fails to develop normally to meet his or
her full human and economic potential.
It is just such an analysis that has brought appropriate attention to conditions
like neuropsychiatric diseases or depression that kill few but disable many. Like-
wise, from placebo-controlled prospective studies of albendazole treatment of
helminthic infections in Kenyan and Jamaican schoolchildren, intestinal hel-
minths have been found to impair growth, fitness, and even cognitive function
(Adams et al., 1994; Nokes et al., 1992a,b; Nokes and Bundy, 1992; Stephenson
et al., 1993). Such studies have enabled Chan and Bundy to suggest potential
recalculation of the long-term impact of childhood helminthic infections on
DALYs to essentially double their previous values (Chan et al., 1994; Guerrant
and Blackwood, 1999).
Indeed, the disability component of the DALY calculations for malnutrition
and the “tropical cluster” (trypanosomiasis, Chagas’ disease, schistosomiasis, and
leishmaniasis), like neuropsychiatric conditions, chronic obstructive lung disease,
and rheumatoid arthritis, outweigh their mortality components (Guerrant and
Blackwood, 1999; Murray and Lopez, 1997). However, the initially calculated
DALY for diarrheal diseases, from a 1997 assessment (Murray and Lopez, 1997),
initially comprised 95 percent mortality (YPLL) and only 5 percent disability
(YLD, from the transient 10 percent incapacitation during just the overt diarrheal
illness [i.e., liquid stools] itself). No long-term disability from repeated dehydrat-
ing and malnourishing diarrheal illnesses in the critical formative developmental

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

IMPLICATIONS FOR DEVELOPING COUNTRIES 85

first 2 years of life is considered, largely because there had been no data to sug-
gest such long-term effects (Guerrant and Blackwood, 1999).

Potential Long-Term Morbidity from Diarrheal Disease

The challenge is to obtain data implicating specific diseases or conditions
with long-term impaired outcomes. Best studied perhaps are nutritional effects
that may even involve genetic “imprinting” from the regulation of critical devel-
opmental genes at pivotal times by DNA methylation, that might further extend
the developmental impact of early childhood illnesses perhaps even beyond 2–3
generations (Golden, 1994). In addition, iron deficiency has a well recognized
impact on cognitive development (Basta et al., 1979; Soewondo et al., 1989).
Nevertheless, despite the lack of a specific single drug (like albendazole for intes-
tinal helminths) to control diarrheal diseases, long-term cohort studies are now
enabling associations to be made of heavy early childhood disease burdens with
later functional as well as nutritional outcomes. The growing evidence for lasting
disability consequences of early childhood diarrhea and specific parasitic infec-
tions (including cryptosporidiosis and intestinal helminthic infections in the first
6–24 months of life) is presented in Table 2-1.
Perhaps one of the greatest of all overlooked costs of the diseases of poverty,
such as diarrhea and intestinal parasitic infections, are the increasingly recog-
nized, long-term developmental impact of early childhood illnesses, so common
in developing areas. For example, we are now learning that the 4–8 dehydrating,
malnourishing diarrheal illnesses that often occur each year in the critically for-
mative first two years of life may have profound, lasting consequences for im-
paired fitness, growth, cognitive development, and school performance several
years later. Initial studies in Northeast Brazil show reduced fitness 4 to 6 years
later associated with early childhood diarrhea, and specifically with
cryptosporidial infections in the first 2 years of life, independent of respiratory
illnesses, anthropometry, anemia, and intestinal helminths (Guerrant and
Blackwood, 1999). The fitness deficits alone that associate with the median diar-
rhea burdens in the first 2 years of life in these studies in Northeast Brazil are
comparable to that associated with a 17 percent decrement in work productivity
in Zimbabwe sugarcane workers (Guerrant et al., 1999; Ndamba et al., 1993).
Furthermore, these early childhood diarrheal illnesses and intestinal helmin-
thic infections in the first 2 years of life independently and additively associate
with substantial long-term linear growth shortfalls that continue beyond six years
of age (totaling an average of 8.2 cm [3 1/4 inches] growth shortfall at 7 years old,
3.6 cm with diarrhea alone after controlling for early childhood intestinal helmin-
thic infections) (Moore et al., 2001). In addition, longitudinal studies in Peru
(Checkley et al., 1997, 1998) have also shown that cryptosporidial infections
(even without overt diarrhea) in young or stunted children predispose to an aver-
age 1 cm growth shortfall 1 year after infection.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

86 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

TABLE 2-1 Evidence for Lasting Disability Effects from Early Childhood
Diarrhea
Disease Outcome References
Growth shortfalls
Cryptosporidial infections Increased diarrhea morbidity and Agnew et al., 1998
and persistent diarrhea nutritional shortfalls for up to Lima et al., 2000
18 months Newman et al., 1999

Cryptosporidial infections 0.95–1.05 cm growth deficits at Checkley et al., 1998

at < 6 months of age and 1 year later
in stunted children
Early childhood diarrhea Lasting growth shortfalls, persisting Moore et al., 2001
(0–2 y.o.) at 3.6 cm at 7 y.o. (additive to 8.2 cm
with intestinal helminths at 0–2 y.o.)
Fitness impairment
Early childhood diarrhea Impaired fitness scores (assessed by the Stephenson et al., 1993
(0–2 y.o.) Harvard Step Test, HST) 4–7 years Guerrant et al., 1999
later (by 4–8.2 percent for median and Ndamba et al., 1993
high diarrhea burdens, respectively;
for comparison, fitness scores improved
6.9 percent 4 months after albendazole
treatment of schoolboys in Kenya and
a 4.3 percent increase in HST scores
correlated with a 16.6 percent increase
in work productivity in sugarcane
cutters in Zimbabwe

Cognitive impairment Impaired cognitive function at 6–9 y.o. Guerrant et al., 1999
Early childhood diarrhea by McCarthy Draw-A-Design
(0–2 y.o.) (p = 0.017 when controlling for early
childhood helminthic infections), and
WISC coding and reverse digit
span testing (p = 0.045)

We also find significant associations of early childhood diarrhea with long-

term cognitive deficits (by standard “Test of Nonverbal Intelligence” [TONI])
even when controlling for maternal education, breast feeding duration, and early
helminthic infections (Niehaus et al., 2002). Furthermore, WISC (Wechsler Intel-
ligence Scale for Children; The Psychological Corp, San Antonio, TX) coding
and digit span scores were lower in children with persistent diarrheal illnesses in
their first 2 years of life, even when controlling for helminths and maternal edu-
cation (Niehaus et al., 2002). And these effects are seen in a “best case” scenario
in which we have documented substantial improvements in disease rates and in
nutritional status over the several years in which we have conducted close, long-
term surveillance of this population (Moore et al., 2000), effects that we have
subsequently not found in other nearby shantytown communities that had not

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

IMPLICATIONS FOR DEVELOPING COUNTRIES 87

TABLE 2-1 Continued

Disease Outcome References

Early childhood diarrhea Impaired Test of Nonverbal Intelligence Niehaus et al., 2002
(0–2 y.o.) (TONI-III) scores at 6–10 y.o., when
controlling for maternal education,
breast feeding duration, and early
helminthic infections; and WISC
coding and digit span scores were lower
in children who had one or more
persistent diarrheal illnesses in their
first 2 years of life.

School performance (increased age at starting school and

age-for-grade)
Early childhood diarrhea Delayed age at starting school and older Lorntz et al., 2000
age-for-grade, independent of maternal
education, socioeconomic status, other
illnesses and of also significant effects
(of ECD) on height for age Z scores
(i.e., stunting) at 0, 2, or 7 years of age
(p < 0.02, N = 77). Late starters also are
2-fold more likely to have experienced
cryptosporidial infections in their
first 2 years of life.

been under such intensive surveillance (Lima, Guerrant et al., unpublished obser-
vations).
We are now finding that these correlations of early childhood diarrhea are
also extending to school performance, with significant associations of diarrhea in
the first 2 years of life with delayed age at starting school and age for grade that
remain even after controlling for maternal education and (also affected) stature.
Late starters are also two-fold more likely to have experienced cryptosporidial
infections (Lorntz et al., 2000).
A recent report describes the significant associations of stunting in the first 2
years of life and multiple episodes of Giardia infection with impaired intelli-
gence quotients on the WISC-R test among children in Peru (Berkman et al.,
2002). This is the setting in which diarrhea is also associated with reduced WISC-
R scores albeit not independently of its association with stunting. This is also the

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

88 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

setting in which cryptosporidial infections are associated with persistent stunting

as well (Checkley et al., 1997, 1998).
Most recently we have launched studies of sensitive measures of higher or-
der frontal lobe development and critical “executive” functioning that predict
functional recovery from brain injury in children. We conducted semantic and
phonetic fluency testing among 74 children who have now reached 6–12 years
old from our prospective surveillance population (with their diarrheal illnesses
recorded from birth). Early childhood diarrhea, whether measured by total num-
bers of episodes or as days of diarrhea in the first 2 years of life was a highly
significant predictor of total fluency scores at 6–12 years of age (i.e., 4–10 years
later). Impressively, early childhood diarrhea remained a significant predictor of
fluency even when controlling for maternal education and for household income
(p = 0.02; beta = –0.31)1 or when controlling for birth size (p = 0.007; beta =
–0.325) or height-for-age Z score (HAZ) at 6.5 years old. Since early childhood
diarrhea has such profound effects on TONI III scores and on HAZ at age 2 years
old, its association with fluency was not significantly independent of TONI III or
HAZ at 2 years old. The persistence of strong associations of early diarrhea with
fluency to 6–12 years old and its independence of HAZ at birth and at 6.5 years
old (despite persistent associations of diarrhea with HAZ to 6–7 years old) sug-
gests that despite the growth effects recovering in part, the lasting impact of early
childhood diarrhea does not recover and is even greater on functional verbal flu-
ency than on growth. We conclude that the higher frontal lobe executive func-
tioning impairment seen at 6–12 years old associated with diarrhea in the first 2
years of life, especially with impaired schooling, growth and cognition, suggest
that early childhood diarrhea results in critical neurodevelopmental impairment
that greatly magnifies the importance of ameliorating these diarrheal illnesses
and their long-term consequences.
These potential consequences of early childhood malnourishing and dehy-
drating diarrheal illnesses should not be a great surprise when one considers the
importance of early childhood years in human brain development (Dobbing, 1985;
1990; Dobbing and Sands, 1985; Niehaus et al., 2002). Unlike other species such
as monkeys, sheep or opossums, which have most of their brain development in
utero, it is during the first 2 years of life in humans that the major brain growth
and synapse formation occurs. Furthermore, if impaired at this formative stage, it
is apparently difficult if not impossible to compensate or build these synapses
later in life. Add to this the recognized potential for genetic imprinting noted
above, and the duration of impact of early childhood illnesses may well be life-
long and even extend even to the next generation(s).
Thus the disability impact and ultimate societal costs of these early child-

1The statistical symbol p stands for the probability that the observed difference could have been

obtained by chance alone, given random variation and a single test of the null hypothesis.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

IMPLICATIONS FOR DEVELOPING COUNTRIES 89

hood diarrheal illnesses of poverty is potentially far greater and more critical a
global investment than is generally appreciated, i.e., a global “tax” that is paid for
the impaired work productivity in the global economy because these largely pre-
ventable illnesses continue unabated. Thus, beyond their obvious human toll, the
diseases of poverty may well require an economic investment (as they are readily
prevented) that we cannot afford not to make.

Persistent High Diarrhea Morbidity Despite Improving Mortality

The importance of an accurate assessment of the YLD, years lost to disabil-
ity from early childhood illnesses like diarrheal diseases is further accentuated by
the striking relative shift from mortality to morbidity seen over recent decades.
Despite clear reductions in diarrhea mortality (from 4.2 to 3.3 to 2.5 million)
from 1955 to the present (Bern et al., 1992; Kosek et al., 2003; Snyder and
Merson, 1982), the morbidity rates from a third 10-year update review (Kosek et
al., 2003) have not decreased; instead, with the fastest growing populations oc-
curring in the poorest areas with the highest disease rates, the total global morbid-
ity from diarrhea has actually substantially increased. The potential impact of
these still common early childhood diarrheal illnesses on long-term development
or disability only further adds to their morbidity costs.

Refining DALYs for Diarrheal Disease

As shown in the first row of Table 2-2, following the standard formulas with
age-weighting and discounting at 3 percent, and all disability falling into the low-
est class (weight of 0.096), the DALY calculations for diarrheal diseases are pre-
sented.
The morbidity in 0–4 year olds is presented in 5 different scenarios as fol-
lows:

• Scenario 1 applies the original assumptions by Murray and Lopez of 2.27

million attacks of 1 week duration, in which the 1.3 million DALYs from morbid-
ity in 0–4 year olds represents 1 percent of the total of 100.9 million global diar-
rhea DALYs.
• Scenario 2 assumes that 17 percent of 0–4 year olds (or 33 percent at half
the 9.6 percent disability weight) are at risk of at least 1 diarrheal attack (or a
diarrhea burden) which could have life-long disability (with a life expectancy of
81.25 years as used by Murray and Lopez).
• Scenario 3 assumes that 25 percent of 0–4 year olds (or 50 percent at half
the 9.6 percent disability weight) are at life-long risk.
• Scenario 4 assumes that 10 percent of 0–4 year olds (or 50 percent at 20
percent of the 9.6 percent disability weight, i.e., half experience a 2 percent life-
long disability).

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

90 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

TABLE 2-2 Revised Calculations of Disability-Adjusted Life Years

(DALYs) for Diarrheal Diseases
DALYS for
morbidity in
0–4 year olds Total
Attack Proportion Duration of (millions) DALYs
Scenario rate/year disabled disability [percentage of total] (millions)
1 3.6 1 0.02 1.3 [1] 100.9
2 1 0.17 81.25 351.7 [78] 451.3
3 1 0.25 81.25 517.2 [84] 616.8
4 1 0.10 81.25 215.2 [68] 314.8
5 1 0.05 81.25 107.6 [52] 207.2

• Scenario 5 assumes that only 5 percent of 0–4 year olds (or half experi-
ence a 1 percent life-long disability).

Thus, a 1 to 4.8 percent disability affecting one-third to one-half of 0–4-year-

old children would increase the total global diarrhea DALYs to 2 to 6-fold the
current estimates. Considered differently, for every 5 percent of children affected
lifelong, DALYs increase by about 100 million; 25 percent of children affected
would increase current DALY estimates by over six-fold; only 5 percent affected
lifelong (or 10 percent affected for only 25 years) would more than double the
total global diarrhea DALYs (Guerrant et al., 2002a).
Add to this the concept that even subclinical enteric infections that may alter
critical absorptive function without necessarily producing overt symptoms of liq-
uid stools, like those with Cryptosporidium or enteroaggregative E. coli may im-
pair growth (Checkley et al., 1997, 1998; Steiner et al., 1998), or impede the
absorption of (and potentially thus enhance resistance to) key anti-HIV or anti-
tuberculosis drugs (Lima et al., 1997; Brantley et al., 2003), and the potential cost
of these diseases of poverty, inadequate water, and inadequate sanitation become
increasingly unacceptable.

Conclusions
Critical to understanding and making this case for investing adequate re-
sources in the presentation or amelioration of the diseases of poverty like diarrhea
is obtaining solid information about the potential long-term correlates with ill-
ness rates and even subclinical infections, controlling to the extent possible the
numerous confounding variables, and careful studies of potential interventions
that could alter these adverse outcomes. Only improved data and careful, accurate
analyses will direct adequate attention to alleviation of these diseases of poverty
that are so potentially costly to human and societal development for us all.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

IMPLICATIONS FOR DEVELOPING COUNTRIES 91

REFERENCES
Adams EJ, Stephenson LS, Latham MC, Kinoti SN. 1994. Physical activity and growth of Kenyan
school children with hookworm, Trichuris trichiura and Ascaris lumbricoides infections are
improved after treatment with albendazole. Journal of Nutrition 124:1199–1206.
Agnew DG, Lima AA, Newman RD, Wuhib T, Moore RD, Guerrant RL, Sears CL. 1998.
Cryptosporidiosis in northeastern Brazilian children: association with increased diarrhea mor-
bidity. Journal of Infectious Diseases 177:754–760.
Basta SS, Soerkirman, D Karyadi, NS Scrimshaw. 1979. Iron deficiency anaemia and the productivity
of males in Indonesia. The American Journal of Clinical Nutrition 32: 916–925.
Berkman DS, Lescano AG, Gilman RH, Lopez SL, Black MM. 2002. Effects of stunting, diarrhoeal
disease, and parasitic infection during infancy on cognition in late childhood: a follow-up study.
Lancet 359:564–571.
Bern C, Martines J, de Zoysa I, Glass RI. 1992. The magnitude of the global problem of diarrhoeal
disease: a ten-year update. Bulletin of the World Health Organization 70:705–714.
Brantley RK, Williams KR, Silva TM, Sistrom M, Thielman NM, Ward H, Lima AA, Guerrant RL.
2003. AIDS-associated diarrhea and wasting in Northeast Brazil is associated with
subtherapeutic plasma levels of antiretroviral medications and with both bovine and human
subtypes of Cryptosporidium parvum. Brazilian Journal of Infectious Diseases 7:16–22.
Chan MS, Medley GF, Jamison D, Bundy DA. 1994. The evaluation of potential global morbidity
attributable to intestinal nematode infections. Parasitology 109:373–387.
Checkley W, Gilman RH, Epstein LD, Suarez M, Diaz JF, Cabrera L, Black RE, Sterling CR. 1997.
Asymptomatic and symptomatic cryptosporidiosis: their acute effect on weight gain in Peruvian
children. American Journal of Epidemiology 145:156–163.
Checkley W, Epstein LD, Gilman RH, Black RE, Cabrera L, Sterling CR. 1998. Effects of
Cryptosporidium parvum infection in Peruvian children: growth faltering and subsequent catch-
up growth. American Journal of Epidemiology 148:497–506.
Dobbing J. 1985. Infant nutrition and later achievement. The American Journal of Clinical Nutrition
41:477–484.
Dobbing J. 1990. Boyd Orr memorial lecture. Early nutrition and later achievement. Proceedings of
the Nutrition Society 49:103–118.
Dobbing J and Sands J. 1985. Cell size and cell number in tissue growth and development. An old
hypothesis reconsidered. Archives Francaises de Pediatrie 42:199–203.
Golden MH. 1994. Is complete catch-up possible for stunted malnourished children? European Jour-
nal of Clinical Nutrition 48:S58–S70.
Guerrant DI, Moore SR, Lima AA, Patrick PD, Schorling JB, Guerrant RL. 1999. Association of early
childhood diarrhea and cryptosporidiosis with impaired physical fitness and cognitive function
four-seven years later in a poor urban community in northeast Brazil. The American Journal of
Tropical Medicine and Hygiene 61:707–713.
Guerrant RL. 2001. The unacceptable costs of the diseases of poverty. Current Infectious Disease
Reports 3:1–3.
Guerrant RL and Blackwood BL. 1999. Threats to global health and survival: the growing crises of
tropical infectious diseases—our “unfinished agenda.” Clinical Infectious Diseases 28:966–986.
Guerrant RL, Kosek M, Lima AA, Lorntz B, Guyatt HL. 2002a. Updating the DALYs for diarrhoeal
disease. Trends in Parasitology 18:191–193.
Guerrant RL, Kosek M, Moore S, Lorntz B, Brantley R, Lima AA. 2002b. Magnitude and impact of
diarrheal diseases. Archives of Medical Research 33:351–355.
Kosek M, Bern C, Guerrant RL. 2003. The global burden of diarrhoeal disease, as estimated from
studies published between 1992 and 2000. Bulletin of the World Health Organization 81:197–
204.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

92 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

Lima AA, Silva TM, Gifoni AM, Barrett LJ, McAuliffe IT, Bao Y, Fox JW, Fedorko DP, Guerrant
RL. 1997. Mucosal injury and disruption of intestinal barrier function in HIV-infected individu-
als with and without diarrhea and cryptosporidiosis in northeast Brazil. American Journal of
Gastroenterology 92:1861–1866.
Lima AA, Moore SR, Barboza MS, Soares AM, Schleupner MA, Newman RD, Sears CL, Nataro JP,
Fedorko DP, Wuhib T, Schorling JB, Guerrant RL. 2000. Persistent diarrhea signals a critical
period of increased diarrhea burdens and nutritional shortfalls: A prospective cohort study among
children in northeastern Brazil. Journal of Infectious Diseases 181:1643–1651.
Lorntz et al. 2000. Presentation at the ASTMH.
Moore SR, Lima AA, Schorling JB, Barboza MS Jr., Soares AM, Guerrant RL. 2000. Changes over
time in the epidemiology of diarrhea and malnutrition among children in an urban Brazilian
shantytown, 1989 to 1996. International Journal of Infectious Diseases 4:179–186.
Moore SR, Lima AA, Conaway MR, Schorling JB, Soares AM, Guerrant RL. 2001. Early childhood
diarrhoea and helminthiases associate with long-term linear growth faltering. International Jour-
nal of Epidemiology 30:1457–1464.
Murray CJ and Lopez AD, eds. 1997. The Global Burden of Disease: A Comprehensive Assessment
of Mortality and Disability from Diseases, Injuries, and Risk Factors in 1900 and Projected to
2020. Cambridge, MA: Harvard University Press.
Murray CJ, Lopez AD, Jamison DT. 1994. The global burden of disease in 1990: summary results,
sensitivity analysis and future directions. Bulletin of the World Health Organization 72:495–
509.
Ndamba J, Makaza N, Munjoma M, Gomo E, Kaondera KC. 1993. The physical fitness and work
performance of agricultural workers infected with Schistosoma mansoni in Zimbabwe. Annals
of Tropical Medicine & Parasitology 87:553–561.
Newman RD, Sears CL, Moore SR, Nataro JP, Wuhib T, Agnew DA, Guerrant RL, Lima AA. 1999.
Longitudinal study of Cryptosporidium infection in children in northeastern Brazil. Journal of
Infectious Diseases 180:167–175.
Niehaus MD, Moore SR, Patrick PD, Derr LL, Lorntz B, Lima AA, Guerrant RL. 2002. Early child-
hood diarrhea is associated with diminished cognitive function 4 to 7 years later in children in a
northeast Brazilian shantytown. The American Journal of Tropical Medicine and Hygiene
66:590–593.
Nokes C and Bundy DA. 1992. Trichuris trichiura infection and mental development in children.
Lancet 339:500.
Nokes C, Grantham-McGregor SM, Sawyer AW, Cooper ES, Bundy DA. 1992a. Parasitic helminth
infection and cognitive function in school children. Proceedings of the Royal Society of London.
Series B Biological Sciences 247:77–81.
Nokes C, Grantham-McGregor SM, Sawyer AW, Cooper ES, Robinson BA, Bundy DA. 1992b.
Moderate to heavy infections of Trichuris trichiura affect cognitive function in Jamaican school
children. Parasitology 104:539–547.
Snyder JD and Merson MH. 1982. The magnitude of the global problem of acute diarrhoeal disease:
a review of active surveillance data. Bulletin of the World Health Organization 60:605–613.
Soewondo S, Husaini M, Pollitt E. 1989. Effects of iron deficiency on attention and learning pro-
cesses in preschool children: Bandung, Indonesia. The American Journal of Clinical Nutrition
50:667–673.
Steiner TS, Lima AA, Nataro JP, Guerrant RL. 1998. Enteroaggregative Escherichia coli produce
intestinal inflammation and growth impairment and cause interleukin-8 release from intestinal
epithelial cells. Journal of Infectious Diseases 177:88–96.
Stephenson LS, Latham MC, Adams EJ, Kinoti SN, Pertet A. 1993. Physical fitness, growth and
appetite of Kenyan school boys with hookworm, Trichuris trichiura and Ascaris lumbricoides
infections are improved four months after a single dose of albendazole. Journal of Nutrition
123:1036–1046.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

IMPLICATIONS FOR DEVELOPING COUNTRIES 93

INFECTIOUS AGENTS AND EPILEPSY

Josemir W. Sander, M.D., Ph.D., M.R.C.P.
Department of Clinical and Experimental Epilepsy
University College London Institute of Neurology, and
WHO Collaborative Centre for Research and Training in Neurosciences
London, United Kingdom

Epilepsy is the tendency to have unprovoked epileptic seizures. Anything

causing structural or functional derangement of the cortical physiology may lead
to seizures and different conditions may express themselves solely by recurrent
seizures and thus be labelled “epilepsy.” The semiology of seizures and the con-
sequences for the sufferers are, however, similar and therefore epilepsy could be
better described as a symptom complex or a condition rather than a disease on its
own right (Sander, 2003).
Throughout the world, epilepsy is the most common serious neurological
condition (Bergen, 1998). In high-income economies its incidence is around 50
per 100,000/year (range 40 to 70 per 100,000/year) and socioeconomically de-
prived people are at higher risk (Heaney et al., 2002). In low income countries
incidence is generally quoted as between 100 and 190 cases per 100,000/year
(Sander, 2003). Most large-scale studies have reported prevalence rates for active
epilepsy between 4 and 10/1,000; many of these studies, particularly in low-in-
come countries, have reported different rates for urban and rural areas, usually
with higher rates in the latter (Sander and Shorvon, 1996). No clear explanation
has been advanced for these differences. It is estimated that worldwide there are
at least 50 million sufferers from epilepsy, the great majority of whom are in low-
income countries (Scott et al., 2001). The overall prognosis for seizure control is
quite good if epilepsy is treated. Epilepsy does, however, carry an increased mor-
tality, particularly if untreated (Cockerell et al., 1994; Sander, 2003).
The range of risk factors for the development of epilepsy varies with age and
geographic location (Sander, 2003). Congenital, developmental and genetic
conditions are mostly associated with the development of epilepsy in childhood,
adolescence and early adulthood. Head trauma, infections of the central nervous
system and tumours may occur at any age and may lead to the development of
epilepsy. Infections of the central nervous system have one of the highest risks
for causing epilepsy (Hauser and Annegers, 1991; Annegers et al., 1996;
Bittencourt et al., 1999). For instance, over three-quarters of the survivors of
cerebral abscess develop severe epilepsy and survivors of viral encephalitis have
an odds ratio of 16.2 for the development of epilepsy (Annegers et al., 1996). In
the elderly, cerebrovascular disease is the commonest risk factor and accounts for
over half the cases of epilepsy in this age group (Sander, 2003). The presence of
a family history of epilepsy seems to enhance other risk factors and this suggests
that the aetiology of epilepsy is multifactorial, with genetic predisposition play-

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

94 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

ing a role (Johnson and Sander, 2001). It might be difficult, however, to say
whether individuals share predisposition or are exposed to the same environmen-
tal sources. In epilepsy due to infections, it could also be argued that the inter-
action between infective agents and social, genetic, and environmental factors
determines the extent of the risk (Bittencourt et al., 1999).
Endemic infections such as malaria, neurocysticercosis and paragonomiasis
are associated with epilepsy in certain environments particularly in low-income
countries (Sander, 2003). Neurocysticercosis, for instance, is the commonest
cause of newly diagnosed epilepsy in large areas of the tropical belt, and malaria
is the commonest cause of fever in febrile convulsions in endemic areas (Medina
et al., 1990; Waruiru et al., 1996; Carpio, 2002). These infections are probably
responsible for the higher incidence of epilepsy in low-income economies and
this makes epilepsy one of the world’s most preventable non-communicable con-
ditions (Commission on Tropical Diseases of the International League Against
Epilepsy, 1994; Bittencourt et al., 1999; Bergen and Silberberg, 2002). This pa-
per briefly reviews central nervous infections and infestations that may lead to
chronic epilepsy. The contribution of social and geographic factors and the
putative pathophysiology are discussed in general terms and the natural history of
the commonest infections is reviewed. Seizures that occur during the acute phase
of an infection are termed acute symptomatic seizures and do not constitute epi-
lepsy even if repeated, and are not covered here.

Social and Geographical Factors

The fact that the incidence of epilepsy seems to be higher in low-income
countries is often attributed to social problems in these countries (Commission on
Tropical Diseases of the International League Against Epilepsy, 1994; Sander
and Shorvon, 1996; Bittencourt et al., 1999). Indeed, poor sanitation and malnu-
trition are risk factors for infections and these are common in low-income coun-
tries. In the past, malaria, schistosomiasis and neurocysticercosis were problems
in parts of the high-income countries but improvements in social conditions and
basic sanitation have resolved this. In most low-income countries there are inad-
equate health delivery systems, which results in late or no diagnosis and treat-
ment for infective conditions that would carry a low risk if prompt action were
instituted. As a result, neurological disabilities, including seizures, may be higher
in survivors of CNS infection in low-income countries than in more developed
economies (Bittencourt et al., 1999).
The tropics provide the ideal environment for a number of organisms that
may occasionally invade the CNS; most of them would not thrive in colder or
temperate climates. Other factors may also play a role: malaria, highly prevalent
in endemic coastal areas and lowlands, is non-existent at higher altitudes. Some
fungi are restricted to small ecological niches. Other agents exhibit seasonal varia-
tion in their infectability. The interaction between infective organism and social,

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

IMPLICATIONS FOR DEVELOPING COUNTRIES 95

geographic and environmental factors determine the extent of infection

(Bittencourt et al., 1999). There is, however, no objective information on the
relative distribution of risk factors or attributable risk for the epilepsies in the
community in most of the world and this is an area that requires urgent research
(Sander and Shorvon, 1996).

Pathophysiology
Seizures in the aftermath of CNS infectious diseases are usually partial or
focal in nature, i.e., they start in the epileptic focus, a localised area of (usually
damaged) cortex (Bittencourt et al., 1999). The route of entry of infective agents
to the CNS may be arterial—(through the blood-brain barrier or the choroid
plexus), by passive venous transport through the spinal plexuses, by direct inva-
sion through trauma or from cranial sinuses. Viruses may enter the CNS by the
haematogenous route or via neuronal routes (Eeg-Olofsson, 2003). The infec-
tious agent needs to reach and damage the cerebral cortex for seizures to develop,
and this may be achieved through various mechanisms (Bittencourt et al., 1999).
Fungal infections are often dependent on the immunological status of the person,
and are therefore more prevalent in immunocompromised subjects. Cortical dam-
age will not invariably lead to epilepsy but is a major risk factor affected by the
location, severity and individual predisposition, which is likely to be genetically
determined (Sander and Shorvon, 1996). There may be months, or even years,
between the insult and the onset of epilepsy and the reasons for this are not well
understood. The existence of critical modulators, which can turn damaged corti-
cal tissue into an epileptic focus, has been postulated (Walker et al., 2002).
Arteritis, ischaemia and infarction are the main pathological outcome of se-
vere viral or bacterial CNS disease and if this affects the cortical ribbon it may be
the substrate for an epileptic focus (Bittencourt et al., 1999). Cerebral malaria
may lead to capillary thrombosis, which is probably caused by intravascular ag-
gregates of parasitised erythrocytes in cerebral tissues, particularly in white mat-
ter (Molyneux, 2000). Astroglial reaction results in the formation of granulomata
and infarcts affecting the cortical ribbon and leading to seizures. Most other pro-
tozoan and helminthic infestations of the CNS lead to formation of granulomata,
which, if located in cortical tissues, may lead to partial seizures (Bittencourt et
al., 1999).

Viral Infections
Among the many viruses that have been associated with the development of
encephalitis are arboviruses, coxsackie, rubella, measles, herpes simplex, flavivirus
(Japanese encephalitis), and cytomegalovirus. Patients may present with seizures
during the acute encephalitic process but more often develop neurological dis-
ability, including epilepsy, as a long-term complication (Eeg-Olofsson, 2003).

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

96 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

Herpes simplex virus is the commonest and most severe viral encephalitis in
immunocompetent subjects and epilepsy as its aftermath is particularly devastat-
ing (Marks et al., 1992).
HIV infections may be complicated by a subacute cortical and subcortical
encephalopathy with progressive dementia, myoclunus and tonic-clonic seizures
(Modi et al., 2000). Partial seizures in patients with HIV are usually the result of
secondary infections with cytomegalovirus, cryptococcus or toxoplasmosis.

Bacterial Infections
Bacterial infections of the CNS usually involve the meninges or cerebral
parenchyma and present as either meningitis or cerebral abscess. Acute bacterial
meningitis is usually caused by H. influenzae, N. meningitidis, S. pneumoniae or
streptococcus infections. Although it may occur in any age group, children are
the group more likely to contract bacterial meningitis. Five to ten percent of sur-
vivors of acute bacterial meningitis will develop chronic epilepsy and this is usu-
ally associated with learning deficits and other neurological disabilities (Marks et
al., 1992; Bittencourt et al., 1999; Oostenbrink et al., 2002).
Cerebral abscesses and intracranial empyemas are usually associated with a
clear port of entry like sinusitis, otitis media, dental abscess or cardiac
valvopathies (Bittencourt et al., 1999). In the majority of cases anaerobic organ-
isms are involved. Epilepsy in the aftermath of a cortical abscess is the rule, and
it is usually highly refractory to treatment and often associated with other neuro-
logical disabilities. Tuberculosis of the central nervous system may involve the
meninges and cerebral parenchyma and is associated with neurological disabili-
ties in a large number of survivors (Bittencourt et al., 1999). Many of these will
have partial epilepsy that is often refractory to treatment.

Fungal Infections
Fungal infections of the CNS are rare in immunocompetent subjects, particu-
larly in high-income economies. The fungi are acquired by inhalation of spores
that lodge initially in the lungs or paranasal sinuses and may seed to any organ,
although with certain topographic preferences depending on the organism
(Bittencourt et al., 1999). C. neoformans, C. immitis, H. capsulatum, C. albicans,
A. fumigatus and A. flavus, and Mucoraceae sp. are the fungal species most likely
to be involved and all of them may eventually provoke seizures.

Protozoal Infections
Plasmodium falciparum and Toxoplasma gondii are associated with epilepsy,
although the former is by far the bigger culprit. Cerebral malaria may develop
abruptly or subacutely, during systemic uncomplicated, as well as during severe,

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

IMPLICATIONS FOR DEVELOPING COUNTRIES 97

falciparum malaria and may have severe consequences. Survivors are at high risk
of neurological disabilities including epilepsy (Waruiru et al., 1996; Molyneux,
2000; Versteeg et al., 2003). It is likely that this is responsible for the higher
prevalence of epilepsy in endemic area. Intrauterine T. gondii infections are asso-
ciated with a severe congenital encephalopathy with epilepsy as one of the symp-
toms. It may also cause seizures in immunocompromised patients. Recently, a
suggestion has been made that it may be responsible for many cases of cryptoge-
nic partial epilepsy but this has not been fully elucidated (Stommel et al., 2001).

Helminthic Infestations
A number of helminthic infestations can occasionally reach the CNS and
lead to seizures. Taenia solium is probably the commonest of these helminthic
infestations but Paragonomiasis westermani, Echinoccocus granulosis,
Spargonomiasis mansonoides and Schistosoma japonicum and S. mansoni have
also been implicated (Pal et al., 2000; Bittencourt et al., 1999). Recently, sugges-
tions have been made that Toxocara canis could be a major culprit for the higher
prevalence of epilepsy in low-income economies (Nicoletti et al., 2002).
Taeniasis and cysticercosis are caused by Taenia solium (Carpio, 2002). They
are closely related to poor sanitation, and the coexistence of humans and pigs is a
major factor. Humans are the final host for Taenia solium while hogs are the
intermediate host. Eating uncooked pork contaminated with taenia cysts will lead
to intestinal taeniasis. When humans, instead of pigs, ingest taenia eggs they may
become the intermediate host and this may lead to neurocysticercosis. In pigs the
cysts tend to lodge in subcutaneous and muscle tissues but in humans there is an
attraction for the brain, particularly well irrigated areas like the cortex and the
choroidal plexus, Here infestation may lead to epilepsy and other neurological
symptoms. Indeed, neurological problems resulting from neurocysticercosis are
very common in vast areas of South America, West Africa and Asia (Medina et
al., 1990; Bergen, 1998; Sander, 2003). Neurocysticercosis is probably the most
preventable form of epilepsy worldwide.
Cerebral hydatidosis is caused by Echinococcus granulosus and occurs in
sheep-raising areas. It is acquired mainly by eating food contaminated with dog
feces. Epilepsy is a rare complication of this condition (Bittencourt et al., 1999).
Paragonimiasis is a parasitic disease caused by Paragonimiasis westermanii
and is common in some endemic areas in the Far East. Like neurocysticercosis, it
may be associated with epilepsy when humans become the intermediate host (usu-
ally a fish). It is acquired by eating undercooked or raw crab or crayfish
(Bittencourt et al., 1999).
A recent report has suggested the possibility of Toxocara canis being the
culprit for partial epilepsy in low-income countries (Nicoletti et al., 2002). An
odds ratio of 18.2 for the development of late onset epilepsy has been reported in
association with positive serology for Toxocara canis. This same study in Bolivia

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

98 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

found an odds ratio for positive serology for Taenia solium of 3.6. This is inter-
esting as, over 30 years ago, Woodruff claimed that dog ownership was a major
risk factor for epilepsy, but this was never taken forward (Woodruff et al., 1966).
Further studies are urgently needed to clarify this issue.

Conclusion
Much of the existing evidence indicates that epilepsy resulting from infec-
tions is a major cause of neurological disability in low-income countries. Indeed,
it is probably responsible for the higher incidence of epilepsy in these areas and is
the commonest preventable cause of epilepsy worldwide. Improvement in basic
sanitation is likely to be crucial to decrease the global burden of epilepsy. Much
remains to be done in this area. Studies are urgently needed to elucidate the whole
spectrum of attributable risk factors for epilepsy. More research is also needed to
understand the molecular basis of all epilepsies particularly the ones caused by
infectious agents.

REFERENCES
Annegers JF, Rocca WA, Hauser WA. 1996. Causes of epilepsy: contributions of the Rochester epi-
demiology project. Mayo Clinic Proceedings 71:570–575.
Bergen DC. 1998. Preventable neurological diseases worldwide. Neuroepidemiology 17:67–73.
Bergen DC and Silberberg D. 2002. Nervous system disorders: a global epidemic. Archives of Neurol-
ogy 59:1194–1196.
Bittencourt PR, Sander JW, Mazer S. 1999. Viral, bacterial, fungal and parasitic infections associated
with seizure disorders. Pp. 145–174 in Handbook of Clinical Neurology, Vol. 72: The Epilep-
sies, H.Meinardi, ed. Amsterdam: Elsevier Sciences.
Carpio A. 2002. Neurocysticercosis: an update. Lancet Infectious Diseases 2:751–762.
Cockerell OC, Johnson AL, Sander JW, Hart YM, Goodridge DM, Shorvon SD. 1994. Mortality from
epilepsy: results from a prospective population-based study. Lancet 344:918–921.
Commission on Tropical Diseases of the International League Against Epilepsy. 1994. Relationship
between epilepsy and tropical diseases. Epilepsia 35:89–93.
Eeg-Olofsson O. 2003. Virological and immunological aspects of seizure disorders. Brain and Devel-
opment 25:9–13.
Hauser WA and Annegers JF. 1991. Risk factors for epilepsy. Epilepsy Research Supplement 4:45–
52.
Heaney DC, MacDonald BK, Everitt A, Stevenson S, Leonardi GS, Wilkinson P, Sander JW. 2002.
Socioeconomic variation in incidence of epilepsy: prospective community based study in south
east England. British Medical Journal 325:1013–1016.
Johnson MR and Sander JW. 2001. The clinical impact of epilepsy genetics. Journal of Neurology,
Neurosurgery, and Psychiatry 70:428–430.
Marks DA, Kim J, Spencer DD, Spencer SS. 1992. Characteristics of intractable seizures following
meningitis and encephalitis. Neurology 42:1513–1518.
Medina MT, Rosas E, Rubio-Donnadieu F, Sotelo J. 1990. Neurocysticercosis as the main cause of
late-onset epilepsy in Mexico. Archives of Internal Medicine 150:325–327.
Modi G, Modi M, Martinus I, Saffer D. 2000. New-onset seizures associated with HIV infection.
Neurology 55:1558–1561.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

IMPLICATIONS FOR DEVELOPING COUNTRIES 99

Molyneux ME. 2000. Impact of malaria on the brain and its prevention. Lancet 355:671–672.
Nicoletti A, Bartoloni A, Reggio A, Bartalesi F, Roselli M, Sofia V, Rosado Chavez J, Gamboa
Barahona H, Paradisi F, Cancrini G, Tsang VC, Hall AJ. 2002. Epilepsy, cysticercosis, and
toxocariasis: a population-based case-control study in rural Bolivia. Neurology 58:1256–1261.
Oostenbrink R, Moons KG, Derksen-Lubsen G, Grobbee DE, Moll HA. 2002. Early prediction of
neurological sequelae or death after bacterial meningitis. Acta Paediatrica 91:391–398.
Pal DK, Carpio A, Sander JW. 2000. Neurocysticercosis and epilepsy in developing countries. Jour-
nal of Neurology, Neurosurgery, and Psychiatry 68:137–143.
Sander JW. 2003. The epidemiology of epilepsy revisited. Current Opinion in Neurology 16:165–
170.
Sander JW and Shorvon SD. 1996. Epidemiology of the epilepsies. Journal of Neurology, Neurosur-
gery, and Psychiatry 61:433–443.
Scott RA, Lhatoo SD, Sander JW. 2001. The treatment of epilepsy in developing countries: where do
we go from here? Bulletin of the World Health Organization 79:344–351.
Stommel EW, Seguin R, Thadani VM, Schwartzman JD, Gilbert K, Ryan KA, Tosteson TD, Kasper
LH. 2001. Cryptogenic epilepsy: an infectious etiology? Epilepsia 42:436–438.
Versteeg AC, Carter JA, Dzombo J, Neville BG, Newton CR. 2003. Seizure disorders among rela-
tives of Kenyan children with severe falciparum malaria. Tropical Medicine and International
Health 8:12–16.
Walker MC, White HS, Sander JW. 2002. Disease modification in partial epilepsy. Brain 125:1937–
1950.
Waruiru CM, Newton CR, Forster D, New L, Winstanley P, Mwangi I, Marsh V, Winstanley M,
Snow RW, Marsh K. 1996. Epileptic seizures and malaria in Kenyan children. Transactions of
the Royal Society of Tropical Medicine and Hygiene 90:152–155.
Woodruff AW, Bisseru B, Bowe JC. 1966. Infection with animal helminths as a factor in causing
poliomyelitis and epilepsy. British Medical Journal 5503:1576–1579.

CONTROL OF INFECTIOUS CAUSES OF CHILDHOOD DISABILITY

IN DEVELOPING COUNTRIES
Maureen Durkin, Ph.D., Dr.P.H.
Department of Population Health Sciences and Waisman Center
University of Wisconsin-Madison, Madison, WI

Too often, infectious diseases have been distinguished from chronic dis-
eases, as though these are mutually exclusive categories competing for recogni-
tion as a leading public health priority. Nowhere is this view less sustainable
than in the field of childhood disability, particularly in developing countries.
Worldwide, infections are among the leading causes of chronic, developmental
disabilities in children, along with and sometimes interacting with genetic and
nutritional causes (Institute of Medicine, 2001). In developing countries today,
infections that are ostensibly preventable or controllable continue to be impor-
tant causes of damage to the developing nervous system resulting in early and
long-term cognitive, motor, seizure, hearing, vision, and behavioral disabilities.
Infectious causes of developmental disabilities thus take a major and potentially
unavoidable toll on the population health and economies of low-income coun-
tries today. This paper reviews some of the major infectious causes of develop-

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

100 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

mental disabilities in low-income countries and discusses strategies and inputs

needed for their prevention.

Congenital Infections
Numerous prenatal infections can damage the developing nervous system or
senses, causing long-term disabilities in children (Levine et al., 2001). The occur-
rence, nature, and severity of effects vary not only with the type of organism but
also often with the timing of the exposure. For example, first or second trimester
exposure to toxoplasmosis, cytomegalovirus, and varicella infections may result
in a range of impairments recognizable at birth, including microcephaly, hydro-
cephaly, growth retardation, blindness, seizures, and skin disorders (Remington
et al., 1995; Dunn et al., 1999), whereas exposure late in pregnancy or during
delivery may result in unapparent infection at birth and onset of developmental
delay during infancy or childhood (Koppe et al., 1986).

Congenital Syphilis
The first congenital disability to be linked to an infectious cause (the spiro-
chete Treponema pallidum), congenital syphilis is preventable through routine
antenatal screening and treatment with penicillin. As a result, it is now a rela-
tively rare occurrence in developed countries, but in some low-resource settings
where routine antenatal care is lacking or where cost barriers prevent access to
treatment, recent studies have reported that 4 to 11 percent of births occur to
women with positive syphilis tests at delivery (Southwick et al., 2001; Frank and
Duke, 2000; Walker and Walker, 2002). The outcomes of congenital syphilis
range from fetal and infant death to premature birth, and survival with or without
neurological manifestations, which can include deafness, interstitial keratitis, and
mental retardation. The most severe outcomes generally result when conception
occurs during the early stages of maternal syphilis infection. Outcomes are less
severe when conception occurs during the latent state of maternal infection, and
clinical manifestations of congenital syphilis are thought to be least severe when
onset of maternal infection occurs during the third trimester of pregnancy (Wicher
and Wicher, 2001). Animal studies suggest that outcomes may also be modulated
by the genetic background of the conceptus (Wicher et al., 1994). Prevention of
congenital syphilis requires interventions to reduce the risk of sexual transmis-
sion to women of childbearing age, and expansion of antenatal screening and
access to treatment. Although the effectiveness and cost-effectiveness of these
interventions have been established in developed countries, a recent study in South
Africa identified logistical difficulties that prevent timely diagnostic results and
access to treatment even when antenatal screening can be accomplished
(Beksinska et al., 2002). These difficulties include late presentation for antenatal
care, transportation delays that delay access to accurate laboratory results, and

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

IMPLICATIONS FOR DEVELOPING COUNTRIES 101

lack of record keeping, tracking mechanisms, and counseling services. Consider-

ations such as these have led some to recommend antibiotic treatment of all preg-
nant women in selected high risk populations (Walker and Walker, 2002).

Congenital Toxoplasmosis
Congenital toxoplasmosis results from transplacental transmission of infec-
tion with the protozoan parasite Toxoplasma gondii following an acute episode of
maternal infection during pregnancy. The clinical manifestations can include
chorioretinitis, intracranial calcification, necrotizing encephalopathy, microceph-
aly, cranial nerve palsies, spastic hemi- or quadriparesis, seizures, cognitive dis-
ability, and death. Clinical signs may be absent at birth, but infants with congeni-
tal toxoplasmosis may develop cognitive and vision disabilities by late childhood.
While the risk of transplacental transmission has been found to increase with
increasing gestational age, approaching 90 percent during the third trimester, the
severity of clinical manifestations appears to decrease with increasing gestational
age (Jones et al., 2001). Those previously uninfected are susceptible to acute
toxoplasmosis infection through ingestion of raw or inadequately cooked infected
meat, contaminated unwashed fruits and vegetables, or oocytes from the feces of
infected cats. Although little is known about the frequency of congenital toxo-
plasmosis in low- and middle-income countries generally, a recent study from
Brazil reported a prevalence of 1 per 3,000 live births (Neto et al., 2000), more
than three times the rate reported in developed countries (Jara et al., 2001). Evi-
dence of the cost-effectiveness and safety of early detection (via prenatal or new-
born screening) and treatment of acute infection with antiparasitics is not consis-
tent or conclusive at this time (Jones et al., 2001; Roizen et al., 1995). Thus,
prevention of congenital toxoplasmosis in low-income countries requires further
research and perhaps more emphasis on educational programs regarding the risks
and specific hygienic precautions that can prevent acute infections during preg-
nancy.

Congenital Rubella
Congenial rubella leads to a range of adverse pregnancy outcomes or birth
defects but only when maternal rubella virus infection occurs within the first 18
weeks of pregnancy. Outcomes include fetal death, spontaneous abortion, still-
birth, premature birth and, among surviving infants, sensorineural deafness, cata-
racts and other visual impairments, mental retardation, autistic features, cardiac
defects, and increased susceptibility to juvenile diabetes and other chronic condi-
tions (Peckham and Newell, 2001). The earlier in gestation that the fetus becomes
infected, the greater the likelihood of multiple defects. Although congenital ru-
bella has been nearly eliminated in successfully vaccinated populations and with
a very high benefit-to-cost ratio (Plotkin et al., 1999), epidemics continue to oc-

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

102 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

cur in many developing countries (Lawn et al., 2000). Cutts and Vynnycky have
concluded from an extensive review of evidence that “Congenital rubella syn-
drome is an under-recognized public health problem in many developing coun-
tries. There is an urgent need for collection of appropriate data to estimate the
cost-effectiveness of a potential global rubella control program” (Cutts and
Vynnycky, 1999). A difficulty facing developing countries is that vaccination can
prevent congenital rubella only if high coverage is maintained. Incomplete vac-
cine coverage may actually increase the risk of congenital rubella infection by
reducing opportunities for natural immunity and increasing the mean age of in-
fection, thus increasing the susceptibility to infection of women of childbearing
age (Panagiotopoulos et al., 1999). The availability of a combined measles and
rubella vaccine may increase the feasibility of achieving adequate rubella vacci-
nation and improve opportunities to prevent congenital rubella throughout the
world (Banatvala, 1998).

Mother-to-Child Transmission of HIV and Herpes Viruses

This is an emerging cause of developmental disabilities in populations where
high HIV prevalence among childbearing women is combined with lack of access
to antenatal antiretroviral therapy and cesarean delivery, which in combination
are highly effective in preventing vertical transmission of HIV (European Mode
of Delivery Collaboration, 1999; International Perinatal HIV Group, 1999). The
neurodevelopmental effects of pediatric AIDS include microcephaly and signifi-
cant delays in cognitive and motor development (Belman, 1990; Macmillan et al.,
2001). These effects may be greater when transmission of the virus from mother
to child occurs in utero or early in gestation versus during parturition (Smith et
al., 2000). In developed countries, improvements in postnatal treatment and sur-
vival of children with HIV may be associated with a reduction in adverse
neurodevelopmental outcomes. One study of HIV-infected children in the US
found no detriment in verbal or performance IQ when compared to controls
matched on ethnicity and prenatal drug exposure (Fishkin et al., 2000). Estimates
are not available of the prevalence of pediatric HIV-associated neurodevelop-
mental disorders from low-income countries where few infected children have
access to antiretroviral therapy. In addition to direct effects of AIDS on the devel-
oping nervous system, the AIDS epidemic may increase children’s exposure to
social, emotional, and economic deprivation during critical periods of develop-
ment. Cost-effective and accessible methods of prevention and treatment of HIV
in developing countries are needed.
Perinatal transmission of herpes viruses, including cytomegalovirus and Her-
pes simplex can also result in severe neurodevelopmental disorders (Levine et al.,
2001; Peckham et al., 1983), but little is known about their occurrence in devel-
oping countries.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

IMPLICATIONS FOR DEVELOPING COUNTRIES 103

Infections Contributing to Perinatal Complications

In addition to infections known to directly damage the developing nervous
system or senses, other prenatal and perinatal infections associated with perinatal
complications may contribute to developmental disabilities either directly or in-
directly (Breslau et al., 1994). Perinatal complications that occur more frequently
in the presence of maternal and fetal infections include premature birth, low birth
weight, intrauterine growth restriction and asphyxia. For example, maternal ma-
laria infection may result in placental parasitemia and intrauterine growth restric-
tion, as well as maternal anemia and death. Infants born with perinatal complica-
tions are often at increased risk for brain and sensory abnormalities and
disabilities. For example, retinopathy of prematurity is a leading cause of child-
hood blindness worldwide (WHO, 2000a), and prematurity is an important risk
factor for cerebral palsy and cognitive disabilities in childhood. Yet the role and
timing of infections in these disorders are not fully understood (Donders et al.,
1993; O’Shea and Dammann, 2000). Many factors may contribute to the elevated
frequency of perinatal complications in low-income countries, including the scar-
city of resources for obstetrical care and management of complications of labor
and delivery, nutritional deficiencies, and increased risk of maternal infections.
Research is urgently needed on the role of maternal infections in the etiology of
adverse perinatal outcomes; on the causal role of infections in developmental
disabilities; and on the impact of infection treatment and control on the preva-
lence of neurodevelopmental disabilities in low-income countries.

Infections During Infancy and Childhood

Infections acquired during infancy and childhood that continue to cause de-
velopmental disabilities among children in low-income countries, where access
to prophylaxis and treatment is often limited and delayed, include neonatal infec-
tions (Wolf et al., 1999; Durkin et al., 2000) as well as bacterial meningitis, viral
encephalitis, measles, poliomyelitis, trachoma, and parasitic conditions such as
malaria, neurocysticercosis, and other helminth conditions (Institute of Medicine,
2001).

Malaria and Helminthic Diseases

Malaria is a public health problem in many countries and is estimated to
cause hundreds of millions of cases and approximately one million deaths in
children each year (WHO, 1998). Repeated episodes of malaria are responsible
for poor school attendance and childhood anemia. Cerebral malaria occurs in a
percentage of affected children, with major clinical manifestations, including con-
vulsions and coma. Measures to prevent malaria infection include use of protec-
tive clothing, insect repellents, insecticide-treated bednets, and environmental

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

104 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

management to control mosquito vectors. Once infection has occurred, chemo-

prophylaxis is effective against the development of disease. The cost-effective-
ness of malaria prophylaxis and treatment programs is well established in popula-
tions where malaria is endemic, even without accounting for the potential for
long-term neurological deficits in children who survive cerebral malaria. Other
parasitic diseases, such as intestinal helminthic diseases, also affect a large pro-
portion of the world’s child population and may adversely affect school perfor-
mance and cognitive development (Dickson et al., 2000).

Meningitis
Meningitis from major bacterial agents probably occurs more commonly in
the developing than in developed countries, though specific data are lacking.
Children under age 5 and the elderly are at highest risk. In developing countries,
pneumonia is the most common presentation of Haemophilus influenzae Type b
meningitis; it has been estimated that this cause of meningitis in developing coun-
tries has a case fatality rate of 30 percent and results in permanent nervous system
impairment in 20 percent of survivors (WHO, 2001a). Meningococcal meningitis
occurs sporadically in developed countries, but major epidemics of the disease
occur every several years in sub-Saharan Africa and South America. Case fatality
exceeds 50 percent in the absence of early and adequate treatment, and it is esti-
mated that 15 to 20 percent of survivors are left with deafness, seizures, and
mental retardation (Levine et al., 1998). Primary prevention of Haemophilus
influenzae Type b meningitis can be achieved by means of vaccination of all
infants or by chemoprophylaxis following close contact with an affected child.
Vaccination is the only practical method of preventing infection on a population
level. In developed countries where immunization against this disease during in-
fancy is routine, the incidence of Haemophilus influenzae Type b meningitis has
dropped dramatically (Levine et al., 1998). It has been argued that vaccination
against Haemophilus influenzae Type b infection is cost-effective in developing
countries as well (Levine et al., 1998), but information on the frequency of the
disease and its sequelae in developing countries is needed to guide the implemen-
tation of control strategies. Epidemics of meningococcal meningitis can be con-
trolled effectively by means of mass immunization campaigns resulting in over
80 percent coverage, while infection in endemic situations can be prevented by
chemoprophylaxis administered to close contacts of patients (Levine et al., 1998).
Information on the cost-effectiveness of these interventions in developing coun-
tries is needed.

Japanese Viral Encephalitis

Japanese viral encephalitis is the leading cause of viral encephalitis in Asia,
where it is responsible for at least 50,000 cases of clinical disease each year,

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

IMPLICATIONS FOR DEVELOPING COUNTRIES 105

primarily among children (Siraprapasiri et al., 1997). Case fatality is as high as 20

percent, and the frequency of neuropsychiatric sequelae among survivors is
thought to be high, though specific data are lacking. Following an infectious mos-
quito bite, the virus replicates in the lymph nodes, spreads to the central nervous
system and propagates in the brain, leading to seizures, cognitive and motor dis-
abilities, and progressive coma (Siraprapasiri et al., 1997). Effective vaccines
have been developed against the viral agent causing Japanese encephalitis. One is
a mouse-brain derived vaccine that has been incorporated effectively into the
national childhood vaccination program of Thailand (Siraprapasiri et al., 1997).
The high cost of this vaccine and the potential for serious neurological sequelae,
however, are barriers to its widespread use in endemic and epidemic situations
(Siraprapasiri et al., 1997).

Measles
Measles is an acute viral disease that is still a leading cause of death world-
wide, largely because of its occurrence among children under age 5 in developing
countries. Rarely (about 1/1,000 cases), measles infection causes encephalitis,
which can result in long-term nervous system sequelae among survivors. While
Vitamin A deficiency has been shown to increase the severity of measles infec-
tion, it is thought the infection can, in turn, exacerbate Vitamin A deficiency and
lead to blindness (Strebel, 1998). Vaccination using live, attenuated measles vi-
rus produces long-lasting immunity. Eradication of measles is theoretically fea-
sible, given the effectiveness of available vaccines and the likelihood that hu-
mans are the only reservoir capable of sustaining transmission of the measles
virus. Widespread vaccination has successfully prevented the spread of measles
in a number of developing countries, and is considered one of the most cost-
effective public health interventions ever undertaken (Strebel, 1998). However,
measles continues to be a major contributor to childhood death and disease world-
wide. Global eradication of this cause of developmental disability will require
sustained efforts.

Poliomyelitis
Polio was eradicated from the Western Hemisphere, the Western Pacific re-
gion, and Eastern Europe following a concerted international initiative (WHO,
2000b). This enteroviral disease, however, continues to threaten children in tropi-
cal Africa and to a lesser extent in South and Southeast Asia. Once established in
the intestines, poliovirus can enter the blood stream and invade the central ner-
vous system. As it multiplies, the virus destroys motor neurons and leads to irre-
versible paralysis. Immunization programs have effectively eradicated poliomy-
elitis from much of the world, but the disease remains endemic in much of
sub-Saharan Africa and parts of South and Southeast Asia. Reported immuniza-

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

106 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

tion coverage with the oral polio vaccine is still low in most African countries
(WHO, 2001b). Although worldwide eradication of polio as a cause of childhood
paralysis can be achieved by vaccination during infancy, meeting this goal will
require major commitments that may be difficult to sustain in the face of the
decline of the disease in much of the world (WHO, 2001b).

Trachoma and Leprosy

Trachoma is a bacterial disease of the conjunctiva caused by Chlamydia
trachomatis (Cook, 1998). Repeated infections, which often begin in childhood,
result in blindness in adulthood. Trachoma is endemic in many impoverished
areas of the world where access to clean water is compromised. An estimated 5.9
million people worldwide have become blind or are at immediate risk for blind-
ness as a result of trachoma infection (Cook, 1998). Improvements in hygiene,
including access to clean water and education to promote frequent face washing,
are highly cost-effective in the prevention of blindness due to trachoma (Helen
Keller International, 2001). Leprosy is another neglected disease with neurologi-
cal effects that continues to affect large numbers of children throughout the de-
veloping world (Jain et al., 2002).

Conclusions
Children in developed countries have benefited for decades from interven-
tions such as maternal vaccination to prevent congenital rubella, pediatric vacci-
nations to prevent potentially brain-damaging childhood infections such as
Haemophilus influenza Type b, and early detection and effective management of
bacterial infections that can lead to meningitis or hearing loss. In addition,
antiretroviral therapies have become available in developed countries to prevent
pediatric HIV transmission. Unfortunately, cost and attitudinal and logistical bar-
riers prevent these interventions from reaching children at greatest risk in the
developing world. Extension of such interventions to low-income countries is a
necessary step toward the reduction of international inequalities in child health.
To effectively respond to the impacts of infectious causes of developmental
disabilities worldwide, proven methods of prevention must be implemented and
expanded within primary health care systems in low-income countries. Specific
interventions should be tailored to local epidemiology and resources and needs,
and should include vaccination programs with high coverage to prevent condi-
tions such as congenital rubella, bacterial meningitis and poliomyelitis, develop-
ment of laboratory facilities and networks to facilitate accurate diagnoses, and
commitment of resources to prevent other infectious diseases, such as pediatric
AIDS, malaria, neurocysticercosis, leprosy, viral encephalitis, and trachoma.
Additional recommendations articulated in the Institute of Medicine report on

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

IMPLICATIONS FOR DEVELOPING COUNTRIES 107

Neurological, Psychiatric and Developmental Disorders: Meeting the Challenge

in the Developing World (Institute of Medicine, 2001) are as follows:

1. Increase training and expertise at all levels of health care, as well as in the
educational and research sectors, in the intersection between infectious disease
control and child development.
2. Develop and maintain Internet cababilities to facilitate international com-
munication among those involved in the implementation of primary prevention
and rehabilitation programs for children with developmental disabilities in low-
income countries.
3. In the context of the successes of current primary health care child sur-
vival initiatives in low-income countries, it is essential that increased emphasis
be placed in low-income countries on prevention and early identification of de-
velopmental disabilities within the primary and maternal and child health care
systems. Those systems must in turn be linked to and supported by secondary and
tertiary medical services, as well as rehabilitation programs.
4. Develop increased capacity for evidence-based research by establishing
regional coordinating centers in low-income countries to enable the conduct of
clinical and community trials of the effectiveness of interventions to prevent in-
fectious causes of developmental disabilities.
5. Support research on factors that are crucial to understanding how to pre-
vent developmental disabilities in low-income countries, such as the etiology and
prevention of adverse perinatal outcomes and the impact of maternal education
and alleviation of poverty on the prevention of infections resulting in develop-
mental disabilities.
6. Develop practical methods for surveillance of infections leading to child-
hood disabilities.
7. Document nervous system sequelae of cerebral malaria and their prevention.
8. Determine the cost-effectiveness of methods for the prevention of preva-
lent infections that result in developmental disabilities.

REFERENCES
Banatvala JE. 1998. Rubella—could do better. Lancet 351:849–850.
Beksinska ME, Mullick S, Kunene B, Rees H, Deperthes B. 2002. A case study of antenatal syphilis
screening in South Africa: successes and challenges. Sexually Transmitted Diseases 29:32–37.
Belman AL. 1990. AIDS and pediatric neurology. Neurologic Clinics 8:571–603.
Breslau N, DelDotto JE, Brown GG, Kumar S, Ezhuthachan S, Hufnagle KG, Peterson EL. 1994. A
gradient relationship between low birth weight and IQ at age 6 years. Archives of Pediatric and
Adolescent Medicine 148:377–383.
Cook JA. 1998. Trachoma. Bulletin of the World Health Organization 76(Suppl 2):139–140.
Cutts FT and Vynnycky E. 1999. Modelling the incidence of congenital rubella syndrome in develop-
ing countries. International Journal of Epidemiology 28:1176–1184.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

108 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

Dickson R, Awasthi S, Williamson P, Demellweek C, Garner P. 2000. Effects of treatment for intes-
tinal helminth infection on growth and cognitive performance in children: systematic review of
randomized trials. British Medical Journal 320:1697–1701.
Donders GG, Desmyter J, De Wet DH, Van Assche FA. 1993. The association of gonorrhoea and
syphilis with premature birth and low birthweight. Genitourinary Medicine 69:98–101.
Dunn D, Wallon M, Peyron F, Petersen E, Peckham C, Gilbert R. 1999. Mother-to-child transmission
of toxoplasmosis: risk estimates for clinical counselling. Lancet 353:1829–1833.
Durkin MS, Khan NZ, Davidson LL, Huq S, Munir S, Rasul E, Zaman SS. 2000. Prenatal and post-
natal risk factors for mental retardation among children in Bangladesh. American Journal of
Epidemiology 152:1024–1033.
European Mode of Delivery Collaboration. 1999. Elective caesarean-section versus vaginal delivery
in prevention of vertical HIV-1 transmission: a randomized clinical trial. Lancet 353:1035–
1039.
Fishkin PE, Armstrong FD, Routh DK, Harris L, Thompson W, Miloslavich K, Levy JD, Johnson A,
Morrow C, Bandstra ES, Mason CA, Scott G. 2000. Brief report: relationship between HIV
infection and WPPSI-R performance in preschool-age children. Journal of Pediatric Psychol-
ogy 25:347–351.
Frank D and Duke T. 2000. Congenital syphilis at Goroka Base Hospital: incidence, clinical features
and risk factors for mortality. Papua New Guinea Medical Journal 43:121–126.
Helen Keller International. 2001. Trachoma. Available at: http://www.hki.org/programs/
trachoma.html.
Institute of Medicine. 2001. Neurological, Psychiatric, and Developmental Disorders: Meeting the
Challenge in the Developing World. Washington, DC: National Academy Press.
International Perinatal HIV Group. 1999. The mode of delivery and the risk of vertical transmission
of human immunodeficiency virus type 1: a meta-analysis of 15 prospective cohort studies. New
England Journal of Medicine 340:977–987.
Jain S, Reddy RG, Osmani SN, Lockwood DN, Suneetha S. 2002. Childhood leprosy in an urban
clinic, Hyderabad, India: clinical presentation and the role of household contacts. Leprosy Re-
view 73:248–253.
Jara M, Hsu HW, Eaton RB, Demaria A Jr. 2001. Epidemiology of congenital toxoplasmosis identi-
fied by population-based newborn screening in Massachusetts. Pediatric Infectious Disease
Journal 20:1132–1135.
Jones JL, Lopez A, Wilson M, Schulkin J, Gibbs R. 2001. Congenital toxoplasmosis: a review. Ob-
stetrical and Gynecological Survey 56:296–305.
Koppe JG, Loewer-Sieger DH, de Roever-Bonnet H. 1986. Results of 20-year follow-up of congeni-
tal toxoplasmosis. Lancet 1:254–256.
Lawn JE, Reef S, Baffoe-Bonnie B, Adadevoh S, Caul EO, Griffin GE. 2000. Unseen blindness,
unheard deafness, and unrecorded death and disability: congenital rubella in Kumasi, Ghana.
American Journal of Public Health 90:1555–1561.
Levine MI, Chervenak FA, Whittle M, eds. 2001. Fetal and Neonatal Neurology and Neurosurgery.
London: Churchill Livingston.
Levine OS, Schwartz B, Pierce N, Kane M. 1998. Development, evaluation and implementation of
Haemophilus influenzae type b vaccines for young children in developing countries: current
status and priority actions. Pediatric Infectious Disease Journal 17 (9 Suppl):S95–113.
Macmillan C, Magder LS, Brouwers P, Chase C, Hittelman J, Lasky T, Malee K, Mellins CA, Velez-
Borras J. 2001. Head growth and neurodevelopment of infants born to HIV-1 infected drug-
using women. Neurology 57:1402–1411.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

IMPLICATIONS FOR DEVELOPING COUNTRIES 109

Neto EC, Anele E, Rubim R, Brites A, Schulte J, Becker D, Tuuminen T. 2000. High prevalence of
congenital toxoplasmosis in Brazil estimated in a 3-year prospective neonatal screening study.
International Journal of Epidemiology 29:941–947.
O’Shea TM and Dammann O. 2000. Antecedents of cerebral palsy in very low birthweight infants.
Clinics in Perinatology 27:285–302.
Panagiotopoulos T, Antoniadou I, Valassi-Adam E. 1999. Increase in congenital rubella occurrence
after immunization in Greece: retrospective survey and systematic review. British Medical Jour-
nal 319:1462–1467.
Peckham CS and Newell ML. 2001. Viral infections. Pp. 553–572 in Fetal and Neonatal Neurology
and Neurosurgery, MI Levine, FA Chervenak, M Whittle, eds. London: Churchill Livingston.
Peckam CS, Chin KS, Coleman JC, Henderson K, Hurley R, Preece PM. 1983. Cytomegalovirus
infection in pregnancy: preliminary findings from a prospective study. Lancet 1:1352–1355.
Plotkin SA, Katz M, Cordero JF. 1999. The eradication of rubella. Journal of the American Medical
Association 281:561–562.
Remington JS, McLeod R, Desmonts G. 1995. Toxoplasmosis. Pp. 140–267 in Infectious Diseases of
the Fetus and Newborn Infant, JS Remington and JO Klein, eds. Philadelphia: WB Saunders.
Roizen N, Swisher CN, Stein MA, Hopkins J, Boyer KM, Holfels E, Mets MB, Stein L, Patel D,
Meier P, et al. 1995. Neurologic and developmental outcome in treated congenital toxoplasmo-
sis. Pediatrics 95:11–20.
Siraprapasiri T, Sawaddiwudhipong W, Rojanasuphot S. 1997. Cost benefit analysis of Japanese
encephalitis vaccination program in Thailand. Southeast Asian Journal of Tropical Medicine
and Public Health 28:143–148.
Smith R, Malee K, Charurat M, Magder L, Mellins C, Macmillan C, Hittleman J, Lasky T, Llorente
A, Moye J. 2000. Timing of perinatal human immunodeficiency virus type 1 infection and rate
of neurodevelopment. The Women and Infant Transmission Study Group. Pediatric Infectious
Disease Journal 19:862–871.
Southwick KL, Blanco S, Santander A, Estenssoro M, Torrico F, Seoane G, Brady W, Fears M, Lewis
J, Pope V, Guarner J, Levine WC. 2001. Maternal and congenital syphilis in Bolivia, 1996:
prevalence and risk factors. Bulletin of the World Health Organization 79:33–42.
Strebel PM. 1998. Measles. Bulletin of the World Health Organization 76 (Suppl. 2):154–155.
Walker DG and Walker GJ. 2002. Forgotten but not gone: the continuing scourge of congenital syphi-
lis. Lancet Infectious Diseases 2:432–436.
Wicher V and Wicher K. 2001. Pathogenesis of maternal-fetal syphilis revisited. Clinical Infectious
Diseases 33:354–363.
Wicher V, Baughn RE, Wicher K. 1994. Congenital and neonatal syphilis in guinea pigs show a
different pattern of immune response. Immunology 82:404–409.
Wolf MJ, Wolf B, Beunen G, Casaer P. 1999. Neurodevelopmental outcome at 1 year in Zimbabwean
neonates with extreme hyperbilirubinaemia. European Journal of Pediatrics 158:111–114.
World Health Organization. 1998. Malaria: Fact Sheet Number 94. Available at: http://www.who.int/
inf-fs/en/fact094.html.
World Health Organization. 2000a. Control of Major Blinding Diseases and Disorders: Fact Sheet
Number 214. Available at: http://www.who.int/inf-fs/en/fact214.html.
World Health Organization. 2000b. Global Polio Eradication Initiative. Available at: http://
www.polioeradication.org/vaccines/polioeradication/all/partners/default.asp.
World Health Organization. 2001a. Haemophilus Influenzae Type b Disease. [Online] Available at:
http://www.who.int/vaccines-diseases/diseases/hib.shtml.
World Health Organization. 2001b. Polio Eradication: Final 1% Poses Greatest Challenge. Available
at: http://www.who.int/inf-pr-2001/en/pr2001-17.html.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

110 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

HTLV-1: CLINICAL IMPACT OF A CHRONIC INFECTION

Eduardo Gotuzzo
Instituto de Medicina Tropical Alexander von Humboldt, Universidad Peruana
Cayetano Heredia
Lima, Peru
and
Kristien Verdonck
Prince Leopold Institute of Tropical Medicine, Antwerp, Belgium

Human T-cell lymphotropic virus type 1 (HTLV-1) was the first human
retrovirus to be described. It was discovered simultaneously in the United States
and in Japan in 1980 (Poiesz et al., 1980; Hinuma et al., 1981). As documented
for all retroviruses, HTLV-1 produces a permanent cell infection. Therefore, all
carriers are potential sources of transmission of the infection.

Epidemiology

Geographical Distribution
HTLV-1 has an ubiquitous distribution, with well-described endemic areas.
An area is called endemic for HTLV-1 if 2–10 percent of the healthy adult popu-
lation is infected. The islands of Kyushu and Okinawa, in southwestern Japan, are
hyperendemic areas for HTLV-1, 15 percent of the healthy adult population carry
the virus (Blattner, 1990). Moderate rates of infection have been reported in West
Africa, Australia, and the Caribbean (Caribbean Epidemiology Center, 1990;
Delaporte et al., 1989; Nerurkar et al., 1993). In South America, Brazil, Colom-
bia, and Peru are HTLV-1 endemic areas (Zurita et al., 1997; Gabbai et al., 1993;
Zaninovic et al., 1994); the virus is also present in Ecuador (Guderian et al.,
1994), Paraguay (de Cabral et al., 1995), Chile (Cartier and Cartier, 1996) and
Argentina (Bouzas et al., 1994). In Peru, the virus is highly prevalent in some
population and ethnic groups. Sixteen percent of immigrants from Japan—par-
ticularly from Okinawa—are seropositive. However, in the first generation of
these immigrants born in Peru, the virus is prevalent in 4 percent of the popula-
tion, and is not present in the second generation (Gotuzzo et al., 1996). Similar
trends were reported in Hawaii (Blattner et al., 1986) and Bolivia (Tsugane et al.,
1988). A study of HTLV-1 infection in asymptomatic women in Peru found preva-
lence rates of 3.8 percent among Afro-American women in Chincha, a coastal
town south of Lima, 1.3 percent among the Quechua population of the central
highlands (Ayacucho) and 3.8 percent in the population of northern Lima
(Sanchez-Palacios, 2003). In other regions in South America, in which there is a
strong presence of African Americans, such as Tumaco (Colombia) and Bahia
(Brazil), the prevalence of HTLV-1 ranges from 2–5 percent in the healthy adult
population.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

IMPLICATIONS FOR DEVELOPING COUNTRIES 111

Transmission
HTLV-1 is transmitted through modes similar to those described for HIV,
but there are also important differences that are explained by the requirement of
infected lymphocytes for the transmission of HTLV-1.

Vertical Transmission
Intrauterine transmission of HTLV-1 is very rare, and prolonged
breastfeeding seems to be the main risk factor associated with this type of trans-
mission. In Peru, breastfeeding is the most common route of transmission of
HTLV-1. In a study of 120 HTLV-1-infected Peruvian women and their off-
spring, infection was not detected in children who were not breastfed, but was
documented in 14 percent of those who received maternal milk for less than 6
months and in 31 percent of those breastfed for more than 6 months (E. Gotuzzo,
unpublished data). Moreover, in a hyperendemic area in southwestern Japan,
screening pregnant women and abstaining from breastfeeding has been docu-
mented to dramatically decrease the prevalence of HTLV-1 (Katamine, 1999).
HTLV-1-related disease in mothers may also be associated with the increased
risk of transmission of the virus to their children, as suggested by a recent study
which found that HTLV-1 is present in 43 percent of children born from mothers
with strongyloidiasis, and 20 percent of children born from mothers with tropical
spastic paraparesis (p < 0.01). Gender also seemed to be a factor, as HTLV-1 is
transmitted to 17 percent of males and to 32 percent of females (p < 0.01) (E.
Gotuzzo, submitted for publication).

Parenteral Transmission
HTLV-1 is transmitted less efficiently than HIV in whole blood transfusions.
Fresh frozen plasma, which can transmit HIV, has not been associated with the
transmission of HTLV-1. In addition, the efficacy of HTLV-1 transmission de-
creases when blood is stored for more than one week (Okochi et al., 1984). These
observations point to the need for viable lymphocytes to establish infection with
HTLV-1. Transmission through transfusion of whole blood has been estimated to
infect between 50 and 60 percent of recipients (Larson and Taswell, 1988). A
national survey in Peru indicated that 1.2 percent of 142,500 blood donors were
HTLV-1 seropositive. Epidemiologic studies of the general population in Carib-
bean countries have consistently shown that the prevalence of HTLV-1 signifi-
cantly increases with age, is higher in women, specifically in low socioeconomic
strata, and correlates with a history of blood transfusion (Murphy et al., 1996).
The efficacy of HTLV-1 transmission through needle sharing by intravenous drug
users is very low (Gradilone et al., 1986).

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

112 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

HTLV-1 as a Sexually Transmitted Disease (STD)

There are several arguments indicating that HTLV-1 is an STD in Latin
America. The virus has been found in semen and cervical secretions of infected
people and sexual intercourse is an important factor for HTLV-1 transmission
(Tajima et al., 1982). Male-female sexual transmission is more efficient than fe-
male-male transmission. Seropositivity is more prevalent in sexual risk groups
such as female commercial sex workers (CSW) (Khabbaz et al., 1990) and pro-
miscuous men engaged in homosexual activities (Bartholomew et al., 1987).. In
such cases, the seropositivity rate is associated with the number of sexual part-
ners, time in prostitution activities, and presence of other STDs. Sexual transmis-
sion of HTLV-1 can be significantly reduced by the consistent use of condoms.
Surveys among female CSW in Peru have shown rates of infection ranging be-
tween 7 and 25 percent (Wignall et al., 1992).

Diseases Associated with HTLV-1

Although HTLV-1 is a life-long retroviral infection, symptoms occur only in
a minority of infected subjects. Classical complications include lymphoprolif-
erative disorders, such as Adult T-cell Leukemia/Lymphoma (ATLL) and au-
toimmune disorders (Tropical Spastic Paraparesis). Both syndromes may occur
in 1–5 percent of HTLV-1-infected subjects (Murphy et al., 1989). Several re-
ports have suggested immune-suppression in HTLV-1-positive patients.

Adult T-Cell Leukemia/Lymphoma (ATLL)

In the 1970s, an epidemic of ATLL was described in Japan (Takatsuki et al.,
1977)—the striking observation being that this phenomenon occurred in Okinawa
and Kyushu and not in northern Japan. In 1980, two groups determined the rela-
tionship between HTLV-1 and ATLL; the HTLV-1 provirus is integrated into the
neoplastic cell DNA and the virus can be isolated from malignant cells (Seiki et
al., 1983). The clinical presentation of ATLL involves fever, lymphadenopathy,
hepatosplenomegaly, bone lesions with hypercalcemia, skin lesions, and a fatal
course with poor response to chemotherapy. Chronic and smoldering types of
leukemia, with more lymphoma-like characteristics, slower courses, and more
extensive skin involvement have also been described. Males aged 50–60 years
are the group most frequently affected. Studies conducted in the HTLV-1 hyper-
endemic areas of Japan have estimated a lifetime risk for ATLL of 2–4 percent
(Tajima and Hinuma, 1992). In Jamaica, Murphy reported the lifetime risk of
ATLL to be 4 percent for those infected with HTLV-1 before 20 years of age
(Murphy et al., 1996). In South America, the association between HTLV-1 and
ATLL has been recognized in Brazil, Colombia, and in Argentina. Three hundred
new cases of non-Hodgkin’s lymphoma are detected at the National Institute of

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

IMPLICATIONS FOR DEVELOPING COUNTRIES 113

Cancer in Lima, Peru, each year, and 10 percent (30) of these cases are associated
with HTLV-1.

Tropical Spastic Paraparesis

The general term “tropical spastic paraparesis” (TSP) was introduced by
Mani et al. in 1969 for a chronic progressive paraparesis of unknown cause ob-
served in tropical areas; however, it was not until 1985 that the association be-
tween this syndrome and HTLV-1 infection was recognized (Gessain et al., 1985).
The designation HTLV-1-associated myelopathy/tropical spastic paraparesis
(HAM/TSP) was proposed in 1989.
It has been reported that TSP occurs in 1–4 percent of people infected with
HTLV-1 (Kaplan et al., 1990).. TSP predominantly affects adult females, an ob-
servation that is also confirmed in WHO’s guidelines for diagnosis of TSP. The
risk of TSP appears to be higher in Latin America than in Japan and associations
have been reported between TSP and certain HLA alleles (Jeffrey et al., 1999).
Furthermore, the association between HTLV-1 and TSP varies between geo-
graphical regions; in Colombia, 87 percent of TSP cases were HTLV-1-seroposi-
tive and in Peru, 55–65 percent of TSP patients were carriers of HTLV-1. On the
other hand, in a study in Mexico, less than 1 percent of TSP cases were found to
carry HTLV-1 (unpublished data, J. Sotelo, Inst Nal Neurol, Mexico City). These
observations suggest that genetic background can influence susceptibility to TSP,
and that HTLV-1 and other cofactors, that remain unknown, are involved in the
pathogenesis of this disease.
An autoimmune mechanism has been proposed to explain the pathogenesis
of TSP. According to this hypothesis, cytokines, such as tumor necrosis factor-α,
are released against viral proteins in the surface of infected lymphocytes thereby
causing chronic inflammation and tissue damage within the thoracic middle por-
tion of the spinal cord.
The clinical symptoms of TSP consist of a gradually appearing symmetrical
paraparesis with signs of pyramidal tract involvement that usually progresses
slowly and relentlessly. However, some patients present rapid progression of the
neurological symptoms; in these patients, higher antibody titers to HTLV-1 have
been found (Nakagawa et al., 1995). In a recent retrospective study in Peru, 22
percent of TSP patients presented rapid progression, defined as less than 2 years
between onset of symptoms and confinement to a wheelchair. Some patients pre-
sented more rapid progression, with the time between onset of symptoms and the
inability to walk unaided as short as 6 months. As noted in a previous report
(Nakagawa et al., 1995), there was an association between age of onset and rapid
progression of TSP; 67 percent of patients with rapid progression were at least 50
years of age at disease onset, compared with 38 percent among slow progressors,
p < 0.01. With the exception of unintentional tremor, no differences were found
in clinical symptoms (38 percent of patients with rapid progression reported

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

114 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

tremor versus 9 percent among slow progressors, p < 0.001) (E. Gotuzzo, unpub-
lished data).
Urinary symptoms are a frequent complaint of TSP patients. Initially, pa-
tients report difficulties to initiate voiding. Not uncommonly, patients mention
the need to put external pressure on their lower abdomen in order to urinate. In
severe cases, patients cannot maintain voiding without compressing the abdo-
men, sometimes leading to urinary retention. Recurrent urinary infections are
common, probably reflecting disorders in bladder emptying. Dysfunction of the
detrusor muscle has been implicated in the urinary tract involvement in TSP.
Manifestations of immune hyperactivity other than TSP—such as Sjögren’s
syndrome, uveitis, arthritis, Behçet’s disease and thyroiditis—have been repeat-
edly observed among patients with TSP.
Currently, there is neither specific nor standardized treatment for HTLV-1
and TSP. Prolonged periods of systemic steroids appear to improve clinical symp-
toms of TSP and recently, antiretroviral drugs effective in treating HIV, such as
lamivudine and zidovudine, have been used with relative success in treating pa-
tients with TSP (Sheremata et al., 1993). A combination of corticosteroids,
antiretroviral drugs, and rehabilitation might considerably improve the quality of
life of TSP patients—particularly if treatment is started early in the course of the
disease in those cases with rapid progression (Araujo et al., 1995).

Association of HTLV-1 with Strongyloidiasis

Strongyloides stercoralis is a soil-transmitted intestinal nematode that has
been estimated to infect at least 60 million people worldwide. Infection is often
asymptomatic, but can cause nonspecific abdominal symptoms and mild diar-
rhea. While strongyloidiasis is generally a self-limited disease in immunocompe-
tent hosts, S. stercoralis behaves as an opportunistic pathogen, producing dis-
seminated and life-threatening infections (Neva, 1986) in immunocompromised
hosts who are incapable of mounting an appropriate immune response. An asso-
ciation of disseminated S. stercoralis infection with malignant tumors, severe
malnutrition, acquired immunodeficiency syndrome (AIDS), corticosteroid
therapy, and renal transplantation has been well documented. Studies in Japan
and Jamaica have shown a significant association between the presence of S.
stercoralis infection and HTLV-1 (Nakada et al., 1984). In Sao Paulo, 12 percent
of HTLV-1-positive blood donors carried strongyloidiasis, compared to 1.6 per-
cent of the control group (Nakada et al., 1984). In our institute in Lima, Peru, 10
percent of strongyloidiasis patients are HTLV-1-positive. Another study con-
ducted in Lima, Peru reveals a strong association between the phenomenon of
hyperinfection with S. stercoralis and HTLV-1. Eighty-six percent (18 out of 21)
of patients with S. stercoralis hyperinfection were infected with HTLV-1, but
were not infected with other immunosuppressive diseases such as AIDS or can-
cer. The difference with the HTLV-1 prevalence in a carefully matched control

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

IMPLICATIONS FOR DEVELOPING COUNTRIES 115

group (5 percent, 1 out of 21) and in a group with intestinal strongyloidiasis (10
percent, 6 of 62) was statistically significant (p < 0.001) (Gotuzzo et al., 1999). A
report of decreased therapeutic efficacy of thiabendazole exists among patients
with concomitant S. stercoralis-HTLV-1 infection in Okinawa (Sato et al., 1994).
Terashima showed that the failure of the standard treatment against intestinal
strongyloidiasis with thiabendazole or ivermectin was an important marker for
suspecting HTLV-1 infection. Some reports suggest that there is a relation be-
tween strongyloidiasis and ATLL in HTLV-1-positive patients. It is not clear
whether Strongyloides acts as a trigger, shortening the incubation time of leuke-
mia, or a marker of high proviral load.

Association of HTLV-1 with Crusted Scabies

Crusted scabies, a severe form of scabies with generalized itching and mas-
sive numbers of mites, has been described among patients undergoing chemo-
therapy and with various immunosuppressive conditions, such as Down’s syn-
drome, cancer, and AIDS (Paterson et al., 1973). Several reports on the association
between HTLV-1 and severe scabies have been published. In a study in 6 hospi-
tals in Lima, Peru, 23 patients were diagnosed with Norwegian scabies over 19
months. Seventy percent of patients were serologically confirmed to have HTLV-
1 infection; 9 percent were on long-term oral corticosteroid treatment; 1 patient
had Down’s syndrome; 2 patients were chronically malnourished; and 2 patients
had no known risk factors for crusted scabies. A study conducted in Bahia, Bra-
zil, found a similar association between HTLV-1 and severe scabies but also
identified dual infection (HIV/HTLV-1) as a risk factor for even more severe
forms of scabies. The crusted form of the disease was highly predictive of double
retroviral infection and seemed to be associated with severe immunodeficiency,
because HIV/HTLV-1 coinfected patients were more likely to die during the study
period. These data suggest that coinfection by HIV-HTLV-1 is associated with a
deeper degree of immunodeficiency, which increases the risk of developing severe
forms of scabies (Brites et al., 2002).

Coinfection of HTLV-1 with HIV

In spite of the similarities between HTLV-1 and HIV with respect to trans-
mission, both epidemics are still largely separated in Peru. Nevertheless, dual
infections do occur. In 1989, 19 percent of HIV-infected Peruvian men and 5
percent of HIV-infected women were found to be HTLV-1 coinfected; and in
men, dual infection was associated with a higher number of sexual partners com-
pared with HIV-only infected patients (Phillips et al., 1991). Dual infection has
also been reported in Trinidad (Bartholomew et al., 1987), Brazil (Cortes et al.,
1989), and the United States (Pierik and Murphy, 1991). Several studies have
suggested that patients with dual infection are at higher risk of developing AIDS

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

116 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

(Bartholomew et al., 1987). In a prospective study of HIV-positive intravenous

drug users, patients infected with both viruses were three times more likely to die
from AIDS during follow-up than those infected with HIV-I alone (Page et al.,
1990). In a Peruvian study, the mortality rate was 63 percent in HIV-infected
patients and 80 percent in dually-infected patients. Of 50 patients who died with-
out receiving any antiretroviral treatment, survival time was 5.02 + 3.27 months
in patients with dual infection, shorter than that of patients with HIV alone (10.07
+ 4.42 months) (Gotuzzo et al., 1992).

Association of HTLV-1 with Tuberculosis

It is well known that the incidence and clinical picture of tuberculosis (TB) is
adversely affected by HIV infection. Similarly, in a Brazilian study, patients with
TB and HTLV-1 exhibited a worse clinical course and a poorer prognosis than
those without HTLV-1. In a study among 131 inpatients with TB in Lima, Peru,
those patients infected with HIV-1 or with HTLV-1 were more likely to die dur-
ing hospitalization than seronegative TB patients (RR = 2.6 for HIV [95 percent
confidence interval = 1.05–6.30] and RR = 5.8 for HTLV-1 [95 percent confi-
dence interval = 2.3–14.3]). The association was particularly strong among pa-
tients infected with both HIV-1 and HTLV-1 (RR = 6.61, 95 percent confidence
interval = 2.5–17.2) (Henriquez et al., 2002).

Association of HTLV-1 with Chronic Infective Dermatitis

The term infective dermatitis was proposed by Sweet in 1966 for a relapsing
eczematous condition in Jamaican children, usually associated with cutaneous
infections by Staphylococcus aureus or β-hemolytic Streptococcus (Sweet, 1966).
In 1990, LaGrenade described an association between chronic infective dermati-
tis and infection with HTLV-1 (LaGrenade et al., 1990). This syndrome has also
been described in Colombia (Blank et al., 1995). Chronic infective dermatitis is
commonly seen in children and is rare in adults. This disease presents with sym-
metric lesions on the scalp, face, armpits, and groin. These lesions improve mark-
edly with antibiotics, but usually relapse when antibiotics are stopped.

Conclusion
HTLV-1 produces three different clinical patterns: lymphoproliferative dis-
ease (ATLL), autoimmune syndromes (TSP), and infections associated with im-
munosuppression (strongyloidiasis, crusted scabies and others). The infection is
endemic in several countries in Latin America. HTLV-1 is transmitted mainly
through breastfeeding, transfusion of whole blood, and as a STD. These modes of
transmission are vulnerable to simple and effective methods of control, such as

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

IMPLICATIONS FOR DEVELOPING COUNTRIES 117

screening of pregnant women and avoiding lactation in those infected, universal

screening of blood donors, and promotion of condom use in sexual risk groups.

REFERENCES
Araujo AQ, Leite AC, Dultra SV, Andrada-Serpa MJ. 1995. Progression of neurological disability in
HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP). Journal of the Neuro-
logical Sciences 129:147–151.
Bartholomew C, Blattner W, Cleghorn F. 1987a. Progression to AIDS in homosexual men co-infected
with HIV and HTLV-I in Trinidad. Lancet 2:1469.
Bartholomew C, Saxinger C, Clark JW, Gail M, Dudgeon A, Mahabir B, Hull-Drysdale B, Cleghorn
F, Gallo RC, Blattner WA. 1987b. Transmission of HTLV-1 and HIV among homosexual men
in Trinidad. Journal of the American Medical Association 257:2604–2608.
Blank A, Herrera M, Lourido MA, Rueda R, Blank M. 1995. Infective dermatitis in Colombia. Lancet
346:710.
Blattner WA. 1990. Epidemiology of HTLV-1 and associated diseases. In Human Retrovirology:
HTLV-1, WA Blattner, ed. New York: Raven Press.
Blattner WA, Nomura A, Clark JW, Ho GY, Nakao Y, Gallo R, Robert-Guroff M. 1986. Modes of
transmission and evidence for viral latency from studies of human T-cell lymphotropic virus
type I in Japanese migrant populations in Hawaii. Proceedings of the National Academies of
Sciences USA 83:4895–4898.
Bouzas MB, Zapiola I, Quiruelas S, Gorvein D, Panzita A, Rey J, Carnese FP, Corral R, Perez C, Zala
C, et al. 1994. HTLV Type I and HTLV Type II infection among Indians and Natives from
Argentina. AIDS Research and Human Retroviruses 10:1567–1571.
Brites C, Weyll M, Pedroso C, Badaro R. 2002. Severe and Norwegian scabies are strongly associated
with retroviral (HIV/HTLV-1) infection in Bahia, Brazil [letter]. AIDS 16:1292–1293.
Caribbean Epidemiology Center. 1990. Public Health Implications of HTLV-1 in the Caribbean.
Weekly Epidemiological Record 65:63–65.
Cartier L and Cartier E. 1996. HTLV-I/II in Chile. Pp. 150–158 in HTLV, Truths and Questions, V
Zaninovic, ed. Cali, Colombia: Fundación MAR.
Cortes E, Detels R, Aboulafia D, Li XL, Moudgil T, Alam M, Bonecker C, Gonzaga A, Oyafuso L,
Tondo M. 1989. HIV-1, HIV-2 and HTLV-I infection in high risk groups in Brazil. New En-
gland Journal of Medicine 320:953–958.
de Cabral MB, Vera ME, Samudio M, Arias AR, Cabello A, Moreno R, Zapiola I, Bouzas MB,
Muchinik G. 1995. HTLV-I/II antibodies among three different Indian groups from Paraguay.
Journal of Acquired Immune Deficiency Syndromes and Human Retrovirology 19:548–549.
Delaporte E, Peeters M, Durand JP, Dupont A, Schrijvers D, Bedjabaga L, Honore C, Ossari S,
Trebucq A, Josse R, et al. 1989. Seroepidemiological survey of HTLV-1 infection among ran-
domized population of western central African countries. Journal of AIDS 2:410–413.
Gabbai AA, Bordin JO, Vieira-Filho JP, Kuroda A, Oliveira AS, Cruz MV, Ribeiro AA, Delaney SR,
Henrard DR, Rosario J, et al. 1993. Selectivity of human T lymphotropic virus type I (HTLV-I)
and HTLV-II infection among different populations in Brazil. American Journal of Tropical
Medicine and Hygiene 49:664–671.
Gessain A, Barin F, Vernant JC, Gout O, Maurs L, Calender A, de The G. 1985. Antibodies to human
T-lymphotropic virus type-I in patients with tropical spastic paraparesis. Lancet 2:407–410.
Gotuzzo E, Escamilla J, Phillips IA, Sanchez J, Wignall FS, Antigoni J. 1992. The impact of human
T lymphotropic virus type I/II infection on the prognosis of sexually acquired cases of acquired
immunodeficiency syndrome. Archives of Internal Medicine 152:1429–1432.
Gotuzzo E, Yamamoto V, Kanna M, et al. 1996. Human T lymphotropic virus type I infection among
Japanese immigrants in Peru. International Journal of Infectious Diseases 1:75–77.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

118 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

Gotuzzo E, Terashima A, Alvarez H, Tello R, Infante R, Watts DM, Freedman DO. 1999. Strongy-
loides stercoralis hyperinfection associated with human T cell lymphotropic virus type-I infec-
tion in Peru. American Journal of Tropical Medicine and Hygiene 60:146–149.
Gradilone A, Zani M, Barillari G, Modesti M, Agliano AM, Maiorano G, Ortona L, Frati L, Manzari
V. 1986. HTLV-1 and HIV infection in drug addicts in Italy. Lancet 2:753–754.
Guderian R, Guevara A, Cooper P, Rugeles MT, Arango C. 1994. HTLV-1 infection and tropical
spastic paraparesis in Esmeraldas Province of Ecuador. Transactions of the Royal Society of
Tropical Medicine and Hygiene 88:399–400.
Henriquez C, Gotuzzo E, Cairampoma, et al. Impact of infection with HIV and/or HTLV-1 on the
outcome of hospitalization for tuberculosis in a public hospital in Peru. Abstract at the 4th World
Congress on Tuberculosis, Washington, DC, June 3–5, 2002.
Hinuma Y, Nagata K, Hanaoka M, Nakai M, Matsumoto T, Kinoshita KI, Shirakawa S, Miyoshi I.
1981. Adult T cell leukemia antigen in an ATL cell line and detection of antibodies to the
antigen in human sera. Proceedings of the National Academy of Sciences USA 78:6476–6480.
Jeffrey KJ, Usuku K, Hall SE, Matsumoto W, Taylor GP, Procter J, Bunce M, Ogg GS, Welsh KI,
Weber JN, Lloyd AL, Nowak MA, Nagai M, Kodama D, Izumo S, Osame M, Bangham CR.
1999. HLA alleles determine human T-lymphotropic virus-I (HTLV-1) proviral load and the
risk of HTLV-1-associated myelopathy. Proceedings of the National Academy of Sciences USA
96:3848–3853.
Kaplan JE, Osame M, Kubota H, Igata A, Nishitani H, Maeda Y, Khabbaz RF, Janssen RS. 1990. The
risk of development of HTLV-1 associated myelopathy/tropical spastic paraparesis among per-
sons infected with HTLV-1. AIDS 3:1096–1101.
Katamine S. 1999. Milk-borne transmission of human T-cell lymphotropic virus Type 1 (HTLV-1)
and its intervention in Nagasaki. Acta Medica Nagasakiensia 44:1–6.
Khabbaz R, Darrow WW, Hartley TM, Witte J, Cohen JB, French J, Gill PS, Potterat J, Sikes RK,
Reich R, et al.. 1990. Seroprevalence and risk factors for HTLV-1 infection among female
prostitutes in the United States. Journal of the American Medical Association 263:60–64.
LaGrenade L, Hanchard B, Fletcher V, Cranston B, Blattner W. 1990. Infective dermatitis of Jamai-
can children: a marker for HTLV-1 infection. Lancet 336:1345–1347.
Larson C and Taswell H. 1988. Human T-cell leukemia virus (HTLV-1) and blood transfusion. Mayo
Clinic Proceedings 63: 869–875.
Mani KS, Mani AJ, Montgomery, RD. 1969. A spastic paraplegic syndrome in South India. Journal
of the Neurological Sciences 9:179–199.
Murphy EL, Hanchard B, Figueroa JP, Gibbs WN, Lofters WS, Campbell M, Goedert JJ, Blattner
WA. 1989. Modelling the risk of adult T cell leukemia/lymphoma in persons infected with
human T lymphotropic virus type I. International Journal of Cancer 43:250–253.
Murphy EL, Wilks K, Hanchard B, Cranston B, Figueroa JP, Gibbs WN, Murphy J, Blattner WA.
1996. A case-control study of risk factors for seropositivity to HTLV-1 in Jamaica. Interna-
tional Journal of Epidemiology 25:1083–1089.
Nakada K, Kohakura M, Komoda H, Hinuma Y. 1984. High incidence of HTLV antibody in carriers
of Strongyloides stercoralis [letter]. Lancet 1:633.
Nakagawa M, Izumo S, Ijichi S, Kubota H, Arimura K, Kawabata M, Osame M. 1995. HTLV-1-
associated myelopathy: analysis of 213 patients based on clinical features and laboratory find-
ings. Journal of Neurovirology 1:50–61.
Nerurkar VR, Song KJ, Saitou N, Melland RR, Yanagihara R. 1993. Interfamilial genomic diversity
and molecular phylogeny of human T-cell lymphotrophic virus type I from Papua New Guinea
and the Solomon Islands. Virology 196:506–513.
Neva FA. 1986. Biology and immunology of human strongyloidiasis. Journal of Infectious Diseases
153:397–406.
Okochi K, Sata H, Hinuma Y. 1984. A retrospective study on transmission of adult T-cell leukemia
virus via blood transfusion: seroconversion in recipients. Vox Sanguinis 46:245–253.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

IMPLICATIONS FOR DEVELOPING COUNTRIES 119

Page JB, Lai SH, Chitwood DD, Klimas NG, Smith PC, Fletcher MA. 1990. HTLV-I/II seropositivity
and death from AIDS among HIV-1 seropositive intravenous drug users. Lancet 335:1439–
1441.
Paterson WD, Allen BR, Beveridge GW. 1973. Norwegian scabies during immunosuppressive
therapy. British Medical Journal 4:211–212.
Phillips I, Hyams KC, Wignall FS, Moran AY, Gotuzzo E, Sanchez J, Roberts CR. 1991. HTLV-1 co-
infection in a HIV-1 infected Peruvian population. Journal of Acquired Immune Deficiency
Syndromes 4:301–302.
Pierik LT and Murphy EL. 1991. The clinical significance of HTLV-I and HTLV-II infection in the
AIDS epidemic. Pp. 41–57 in AIDS Clinical Review, P Volberding and MA Jacobson, eds. New
York: Marcel Dekker.
Poiesz BJ, Ruscetti FW, Gadzar AF, Bunn PA, Minna JD, Gallo RC. 1980. Detection and isolation of
type C retrovirus particles from fresh and cultured lymphocytes of a patient with cutaneous T
cell lymphoma. Proceedings of the National Academy of Sciences USA 77:7415–7419.
Sanchez-Palacios C, Gotuzzo E, Vandamme AM, Maldonado Y. 2003. Seroprevalence and risk fac-
tors for human T-cell lymphotropic virus (HTLV-1) infection among ethnically and geographi-
cally diverse Peruvian women. International Journal of Infectious Diseases 7:132–137.
Sato Y, Shiroma Y, Kiyuna S, Toma H, Kobayashi J. 1994. Reduced efficacy of chemotherapy might
accumulate concurrent HTLV-1 infection among strongyloidiasis patients in Okinawa, Japan.
Transactions of the Royal Society of Tropical Medicine and Hygiene 88:59.
Seiki M, Hattori S, Hirayama Y, Yoshida M. 1983. Human adult T-cell leukemia virus: Completed
nucleotide sequence of the provirus genoma integrated in leukemia cell DNA. Proceedings of
the National Academy of Sciences USA 80:3618–3622.
Sheremata WA, Benedict D, Squilacote DC, Sazant A, DeFreitas E. 1993. High-dose zidovudine
induction in HTLV-1-associated myelopathy: safety and possible efficacy. Neurology 43:2125–
2129.
Sweet RD. 1966. A pattern of eczema in Jamaica. British Journal of Dermatology 78:93–100.
Tajima K and Hinuma Y. 1992. Epidemiology of HTLV-I/II in Japan and the world. Gann Mono-
graph on Cancer Research 39:129–149.
Tajima K, Tominaga S, Suchi, Kawagoe T, Komoda H, Hinuma Y, Oda T, Fujita K. 1982. Epidemio-
logical analysis of the distribution of antibody to adult T-cell leukemia-virus-associated antigen:
possible horizontal transmission of adult T-cell leukemia virus. Gann 73:893–901.
Takatsuki K, Uchiyama J, Sagawa K, Yodoi J. 1977. Adult T-cell leukemia in Japan. Pp. 73–77 in
Topics in Hematology, S Sano, F Takaku, S Irino, eds. Amsterdam: Excerpta Medica.
Tsugane S, Watanabe S, Sugimura H, Otsu T, Tobinai K, Shimoyama M, Nanri S, Ishii H. 1988.
Infectious status of human T lymphotropic virus type I and hepatitis B virus among Japanese
immigrants in the Republic of Bolivia. American Journal of Epidemiology 128:1153–1161.
Wignall FS, Hyams KC, Phillips IA, Escamilla J, Tejada A, Li O, Lopez F, Chauca G, Sanchez S,
Roberts CR. 1992. Sexual transmission of human T-cell lymphotropic virus type I in Peruvian
prostitutes. Journal of Medical Virology 38:44–48.
Zaninovic V, Sanzón F, López F, Velandia G, Blank A, Blank M, Fujiyama C, Yashiki S, Matsumoto
D, Katahira Y, et al. 1994. Geographic independence of HTLV-I and HTLV-II foci in the Andes
Highland, the Atlantic Coast, and the Orinoco of Colombia. AIDS Research and Human
Retroviruses 10:97–101.
Zurita S, Costa C, Watts D, Indacochea S, Campos P, Sanchez J, Gotuzzo E. 1997. Prevalence of
human retroviral infection in Quillabamba and Cuzco, Peru: a new endemic area for human T-
cell lymphotropic virus type 1. American Journal of Tropical Medicine and Hygiene 56:561–
565.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

120 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

PROGRESSION OF HEPATITIS C VIRUS INFECTION WITH AND

WITHOUT SCHISTOSOMIASIS
Sanaa Kamal, M.D.
Ain Shams University, Cairo, Egypt

Hepatitis C virus (HCV) infects an estimated 170 million persons world-

wide, and is a major cause of morbidity in developed and developing countries. In
the United States, nearly 2 percent of the population is infected with this positive
strand RNA virus from the flavivirus family (Seeff, 1997; Alter, 1997). In other
regions, the prevalence of HCV infection is even higher reaching up to 10 percent
to 31 percent of the population in some countries (Abdel Aziz et al., 2000; Habib
et al., 2001). Approximately 70 percent of infected persons will go on to develop
chronic hepatitis, and 15 to 20 percent will eventually develop cirrhosis. HCV-
related cirrhosis is also one of the major risk factors for the development of
hepatocellular carcinoma (Seeff, 1997). Despite recent improvements in treating
HCV infection using interferon-alpha and ribavirin, about half of infected indi-
viduals will fail treatment or cannot be treated due to contraindications (Poynard
et al., 1996; Thevenot et al., 2001). Also, for many persons worldwide, antiviral
therapy is out of reach due to its prohibitive costs. Therefore, the development of
an effective vaccine to prevent the continued spread of HCV infection remains an
urgent goal. Likewise, a better understanding of the immunopathogenesis of this
infection may facilitate the development of immunotherapeutic strategies to treat
infected persons.

CD4 Response to HCV Infection

The host immune response probably plays a critical role in both control of
HCV replication and liver injury. HCV infection evokes CD4+, HLA class II-
restricted (Cerny and Chisari, 1999; Diepolder et al., 1996) and CD8+ (CTL)
HLA class I-restricted T-cell response (Lechner et al., 2000; He et al., 1999). In
the absence of an appropriate small animal model, studying the immunological
events that occur in the earliest stages of infection in patients with acute hepatitis
C infection thus offers the unique opportunity to identify efficient immune mecha-
nisms of virus control and to characterize the factors determining the eventual
outcome of disease. Several studies in individuals who experienced complete
virologic recovery have found a significant association between a strong and
maintained HCV-specific CD4+ T-cell response and viral clearance in acute hepa-
titis C (Gerlach et al., 1999; Kamal et al., 2001). As HCV-specific cellular im-
mune responses are present in chronic infection, the other consideration is that
the cytokine response may be qualitatively different in individuals with chronic
infection as compared with acute resolved HCV. Analysis of the cytokine profile
of bulk cultures as well as CD4+ T-cell clones from patients with hepatitis C
revealed that viral clearance is more likely in cases displaying a T-helper 1 pro-

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

IMPLICATIONS FOR DEVELOPING COUNTRIES 121

file (Koziel, 1999). However, most studies are based on few individuals who
recovered infection either spontaneously or after interferon therapy (Gerlach et
al., 1999; Lohr et al., 1998). Thus longitudinal prospective studies analyzing the
early antiviral immune responses in acute hepatitis C infection are crucial for
understanding the pathogenesis of the disease and potentially in vaccine design.
Once chronic infection is established HCV-specific CD4+ T-cells compartmen-
talize in the liver and differ functionally and clontypically from those in the pe-
ripheral blood (Schirren et al., 2000; Bertoletti et al., 1997). The significance of
the intrahepatic CD4+ responses and their relation to liver injury have not been
comprehensively investigated since most studies focus on the peripheral com-
partment due to the difficulty in obtaining liver biopsies.

CD8 Response to HCV Infection

The CD8+ T-cell response is thought to play a crucial role in the course of
HCV infection. In humans and in chimpanzees, a strong and broadly directed
HCV-specific CTL response has been associated with viral clearance during acute
HCV infection. In contrast, individuals with chronic infection are often found to
have a relatively weak and narrowly directed CD8+ T-cell response against HCV
(Lechner et al., 2000; He et al., 1999). Whether these responses in chronic disease
are still beneficial in containing viral replication or whether they are mediators of
hepatic injury and disease is unclear. In several studies, the magnitude of the
HCV-specific CD8+ T-cell response has been correlated to HCV viral load and to
liver histology, but the results of these studies have been controversial. Overall,
the levels of responses detected by most investigators have been fairly low, using
a variety of methods, compared to those found in many other viral infections.

CTL Response to HCV Infection

Despite an occasionally broadly directed CTL response, virus persists within
the liver, demonstrating the typical lack of effective clearance of infected hepato-
cytes by this response (Cerny and Chisari, 1999; Lechner et al., 2000; He et al.,
1999). In fact, CTL have been hypothesized to contribute to liver pathology, per-
haps by chronic secretion of cytokines that may enhance the development of
cirrhosis. The reasons that the CTL response is unable to clear infection remain
unclear. Possible mechanisms include escape of the virus from CTL epitopes,
dysfunctional CTL, or direct inhibition of CTL through the virus.

Schistosomiasis and HCV Infection

Schistosomiasis is a chronic helminthic disease infecting more than 200 mil-
lion people worldwide (Chitsulo et al., 2000). Infection with Schistosoma mansoni
is endemic in Egypt with a prevalence range of 17.5 percent to 42.9 percent (El-

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

122 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

Khoby et al., 2000; Hammam et al., 2000). Morbidity in humans infected with S.
mansoni results primarily from deposition of parasite ova in the portal areas in-
ducing a T-cell-dependent granulomatous response which progresses to irrevers-
ible fibrosis and severe portal hypertension in more than 60 percent of cases. S.
mansoni infection in mice is characterized by a strong Th2-associated immune
response coupled with a defect in Th1-cell effector function (Sabin and Pearce,
1995). Although a predominant Th2 profile was shown to be beneficial in
polyparasitism, where mice infected with S. mansoni are capable of eliminating
Trichuris muris infection more efficiently than non-infected mice (Curry et al.,
1995), it is assumed to be harmful in most viral infections.
Concomitant schistosomiasis and HCV infection is common in Egypt and
other developing countries (Kamal et al., 2000a; Angelico et al., 1997; Pereira et
al., 1995). Patients with concomitant HCV and schistosomiasis exhibit a unique
clinical, virological, and histological pattern manifested by virus persistence with
high HCV RNA titers, higher necroinflammatory and fibrosis scores in their liver
biopsies and poor response to interferon therapy (Kamal et al., 2000a; Angelico
et al., 1997; Pereira et al., 1995; Kamal et al., 2000b). This results in a markedly
accelerated disease course once chronic HCV infection has been established. Our
understanding of the pathomechanisms leading to this accelerated disease pro-
gression in HCV/S. mansoni coinfection is still extremely limited. This
coinfection should be a valuable model to study the effect of one pathogen on the
pathogenesis of the other agent, especially the influence of an altered T helper
cell response on the other arms of the immune response as well as the clinical
outcome. The model of HCV/S. mansoni coinfection also offers a unique oppor-
tunity to define the role of HCV-specific T-cells in viral control as well as the
pathogenesis of HCV-related liver disease.
Comprehensive study of the different aspects of HCV/S. mansoni coinfection
has been conducted and the data were presented in several publications. These
studies, described below, provide insight into the mechanisms through which
infection with one pathogen can influence the immunopathogenesis and the clini-
cal course of another.

• Chronic HCV and S. mansoni coinfection is associated with more se-

vere disease (Kamal et al., 2000a). One hundred and twenty-six patients with
either chronic hepatitis C (group A), chronic schistosomiasis (group B), and
chronic hepatitis C and schistosomiasis (group C) were enrolled and prospec-
tively followed for 67.2 ± 22 months. HCV RNA titers were significantly higher
in the coinfected group. Patients with coinfection showed higher fibrosis scores
in their liver biopsies. Hepatocellular carcinoma was detected only in patients
with coinfection. During follow-up, the mortality due to liver-related causes was
2 percent, 3 percent, and 48 percent in groups A, B, and C, respectively. In con-
clusion, patients with concomitant HCV and schistosomiasis are characterized
through more advanced liver disease, higher HCV RNA titers, higher incidence

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

IMPLICATIONS FOR DEVELOPING COUNTRIES 123

of cirrhosis and hepatocellular carcinoma as well as higher incidence of liver-

related morbidity and mortality.
• HCV and S. mansoni coinfection is associated with poor response to
interferon therapy (Kamal et al., 2000b). Sixty-two patients (28 with chronic
HCV and 34 patients with HCV and S. mansoni) were treated with interferon α-
2b. The end of treatment response was 20 percent in coinfected patients versus 36
percent in monoinfected patients. The sustained response rate was 3 percent in
coinfected patients versus 20 percent in monoinfected patients. In conclusion,
patients with chronic hepatitis C coinfected with schistosomiasis respond poorly
to interferon therapy and have higher relapse rates compared to patients with
chronic HCV monoinfection.
• Patients with HCV and S. mansoni coinfection fail to mount signifi-
cant HCV-specific CD4+ T-cell responses and show alteration in the cytokine
milieu along with more severe liver disease (Kamal et al., 2001a). To define if
immunological mechanisms are responsible for this alteration in the natural his-
tory of HCV, the HCV-specific peripheral CD4+ T-cell responses and cytokines
were analyzed in patients with chronic hepatitis C monoinfection, patients with S.
mansoni monoinfection and patients with hepatitis C virus and S. mansoni
coinfection. HCV-specific CD4+ proliferative responses to at least one HCV an-
tigen were detected in 73.3 percent patients with HCV monoinfection compared
to 8.6 percent coinfected with S. mansoni. Stimulation with HCV antigens pro-
duced a type 1 cytokine profile in patients with HCV monoinfection compared to
type 2 predominance in patients with coinfection. In contrast, there was no differ-
ence in response to schistosomal antigens in patients with S. mansoni infection
compared to those with coinfection. These findings suggest that the inability to
generate HCV-specific CD4+/Th1 T-cell response plays a role in the persistence
and severity of HCV infection in patients with coinfection.
• Patients with acute hepatitis C and schistosomiasis coinfection cannot
clear viremia and show rapid progression once chronic infection is estab-
lished (Kamal et al., 2001b). Immune responses during the first few months of
acute HCV infection seem crucial for viral control, but the relationship of these
responses to natural history is poorly characterized. We prospectively investi-
gated the HCV-specific CD4+ and cytokine responses in patients with acute HCV
hepatitis with or without S. mansoni coinfection, a parasitic infection with T helper
(Th) 2 immune bias. HCV-specific CD4+ proliferative responses and cytokine
production in peripheral blood mononuclear cells (PBMCs) were correlated with
liver biopsy results at six months and end of follow-up. Whereas 5 of 15 patients
with HCV alone recovered from acute HCV, all (17/17) patients with S. mansoni
coinfection progressed to histologically proven chronic hepatitis. Coinfected pa-
tients had either absent or transient weak HCV-specific CD4+ responses with
Th0/Th2 cytokine production. The magnitude of the HCV-specific CD4+ re-
sponse at week 12 was inversely correlated with the HCV RNA titers and the
fibrosis progression rate in chronically infected patients.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

124 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

We are currently conducting comprehensive and sensitive analysis of HCV-

specific CTL and CD4+ responses in PBMCs and liver-infiltrating lymphocytes
of patients coinfected with HCV and S. mansoni versus HCV-monoinfected pa-
tients.

Conclusion
In summary, HCV infection is a worldwide problem for which there has been
insufficient success with treatment options presently available. The lack of a clear
understanding of the immunological events during acute and chronic infection
has hampered vaccine development and immunotherapeutic approaches to treat-
ment. From an immunological point of view the interplay between T helper cell
responses and CTL has been difficult to assess in humans, and infection with S.
mansoni offers the unique situation of studying the impact of an altered response
on the outcome and progression of HCV-related liver disease.

REFERENCES
Abdel Aziz F, Habib M, Mohamed M, Abdel Hamid M, Gamil F, Madkour S, Mikhail N, Thomas D,
Fix A, Strickland T, Anwar W, Ismail S. 2000. Hepatitis C virus infection in a community in the
Nile Delta: population description and HCV prevalence. Hepatology 32:111–115.
Alter MJ. 1997. Epidemiology of hepatitis C. Hepatology 26:62S–65S.
Angelico M, Renganathan E, Gandin C, Fathy M, Profili MC, Refai W, De Santis A, Nagi A, Amin
G, Capocaccia L, Callea F, Rapicetta M, Badr G, Rocchi G. 1997. Chronic liver disease in
Alexandria governorate, Egypt: contribution of schistosomiasis and hepatitis virus infections.
Journal of Hepatology 26:236–243.
Bertoletti A, D´Elios MM, Boni C, De Carli M, Zignego AL, Durazzo M, Missale G, Penna A,
Fiaccadori F, Del Prete G, Ferrari C. 1997. Different cytokine profiles of intrahepatic T cells in
chronic hepatitis B and hepatitis C virus infections. Gastroenterology 112:193–199.
Cerny A and Chisari FV. 1999. Pathogenesis of chronic hepatitis C: immunological features of he-
patic injury and viral persistence. Hepatology 30:595–601.
Chitsulo L, Engels D, Montresor A, Savioli L. 2000. The global status of schistosomiasis and its
control. Acta Tropica 77:41–51.
Curry AJ, Else KJ, Jones F, Bancroft A, Grencis RK, Dunn DW. 1995. Evidence that cytokine-
mediated immune interactions induced by Schistosoma mansoni alter disease outcome in mice
concurrently infected with Trichuris muris. The Journal of Experimental Medicine 181:769–
774.
Diepolder HM, Zachoval R, Hoffmann RM, Jung MC, Gerlach T, Pape GR. 1996. The role of hepa-
titis C virus specific CD4+ T lymphocytes in acute and chronic hepatitis C. Journal of Molecu-
lar Medicine 74:583–588.
El-Khoby T, Galal N, Fenwick A, Barakat R, El-Hawey A, Nooman Z, Habib M, Abdel Wahab F,
Gabr NS, Hammam HM, Hussein MH, Mikhail NN, Cline BL, Strickland GT. 2000. The epide-
miology of schistosomiasis in Egypt: summary of findings in nine governorates. The American
Journal of Tropical Medicine and Hygiene 62:88–99.
Gerlach T, Diepolder H, Jung M, Gruner N, Schraut W, Zachoval R, Hoffman R, Schirren A,
Santantonio T, Pape G. 1999. Recurrence of hepatitis C virus after loss of virus specific CD4+
T-cell response in acute hepatitis C. Gastroenterology 117:993–941.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

IMPLICATIONS FOR DEVELOPING COUNTRIES 125

Habib M, Mohamed MK, Abdel-Aziz F, Magder LS , Abdel-Hamid M, Gamil F, Madkour S, Mikhail

NN, Anwar W, Strickland GT, Fix AD, Sallam I. 2001. Hepatitis C virus infection in a commu-
nity in the Nile Delta: risk factors for seropositivity. Hepatology 33:248–253.
Hammam HM, Allam FA, Moftah FM, Abdel-Aty MA, Hany AH, Abd-El-Motagaly KF, Nafeh MA,
Khalifa R, Mikhail NN, Talaat M, Hussein MH, Strickland GT. 2000. The epidemiology of
schistosomiasis in Egypt: Assiut governorate. The American Journal of Tropical Medicine and
Hygiene 62:73–79.
He XS, Rehermann B, Lopez-Labrador FX, Boisvert J, Cheung R, Mumm J, Wedemeyer H, Berenguer
M, Wright TL, Davis MM, Greenberg HB. 1999. Quantitative analysis of hepatitis C virus-
specific CD8(+) T cells in peripheral blood and liver using peptide-MHC tetramers. Proceed-
ings of the National Academy of Sciences USA 96:5692–5697.
Kamal SM, Madwar MA, Bianchi L, EL Tawil A, Fawzy R, Peters T, Rasenack JW. 2000a. Clinical,
virological and histopathological features: long-term follow-up in patients with chronic hepati-
tis C co-infected with Schistosoma mansoni. Liver 20:281–289.
Kamal SM, Madwar MA, Peters T, Fawzy R, Rasenack J. 2000b. Interferon therapy in patients with
hepatitis C and schistosomiasis. Journal of Hepatology 32:172–174.
Kamal SM, Bianchi L, Al Tawil A, Koziel M, El Sayed Khalifa K, Peter T, Rasenack JW. 2001a.
Specific cellular immune response and cytokine patterns in patients coinfected with hepatitis C
virus and Schistosoma mansoni. The Journal of Infectious Diseases 184:972–982.
Kamal SM, Rasenack JW, Bianchi L, Al Tawil A, El Sayed Khalifa K, Peter T, Mansour H, Ezzat W,
Koziel M. 2001b. Acute hepatitis C with and without schistosomiasis: correlation with hepatitis
C-specific CD4+ T-cell and cytokine response. Gastroenterology 121:646–656.
Koziel MJ. 1999. Cytokines in viral hepatitis. Seminars in Liver Disease 19:157–169.
Lechner F, Wong D, Dunbar R, Chapman R, Chung R, Dohrenwend P, Robins G, Phillips R,
Klenerman P, Walker B. 2000. Analysis of successful immune responses in persons infected
with hepatitis C virus. Journal of Experimental Medicine 1499–1512.
Lohr HF, Gerken G, Roth M, Weyer S, Schlaak JF, Meyer zum Buschenfelde KH. 1998. The cellular
immune responses induced in the follow-up of interferon-alpha treated patients with chronic
hepatitis C may determine the therapy outcome. Journal of Hepatology 29:524–532.
Pereira LM, Melo MC, Saleh MG, Massarolo P, Koskinas J, Domingues AL, Spinelli, Mies S, Will-
iams R, McFarlane IG. 1995. Hepatitis C virus infection in Schistosomiasis mansoni in Brazil.
Journal of Medical Virology 45:423–428.
Poynard T, Leroy V, Conhard M. 1996. Meta-analysis of interferon randomized trials in the treatment
of viral hepatitis C: effects of dose and duration. Hepatology 24:278–289.
Sabin EA and Pearce EJ. 1995. Early IL-4 production by non-CD4+ cells at the site of antigen depo-
sition predicts the development of a T helper 2 cell response to Schistosoma mansoni eggs.
Journal of Immunology 155:4844–4855.
Schirren CA, Jung MC, Gerlach JT, Worzfeld T, Baretton G, Mamin M, Hubert Gruener N, Houghton
M, Pape GR. 2000. Liver-derived hepatitis C virus (HCV)-specific CD4+ T cells recognize
multiple HCV epitopes and produce interferon gamma. Hepatology 32:597–603.
Seeff LB. 1997. Natural history of hepatitis C. Hepatology 26:21S–28S.
Thevenot T, Rigimbeau C, Ratziu V, Leroy V, Opolon P, Poynard T. 2001. Meta-analysis of inter-
feron randomized trials in the treatment of viral hepatitis C in naive patients: 1999 update.
Journal of Viral Hepatitis 8:48–62.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

126 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

INTERACTIONS OF MULTIPLE INFECTIOUS AGENTS IN

MALARIA-ENDEMIC AREAS:
CONCURRENT HIV/AIDS AND MALARIA
Altaf A. Lal, Ph.D.
Division of Parasitic Diseases, National Center for Infectious Diseases
Centers for Disease Control and Prevention, Atlanta, GA

Establishment of microorganisms in human host populations requires struc-

tural, biologic, and molecular compatibilities between the host and pathogen. In
situations where multiple infectious organisms coexist in an individual, the re-
sulting polyparasitism could lead to increased infectivity, altered pathogen load,
and modulation in pathogenesis. Burkitt’s lymphoma, which is commonly found
in areas with malaria transmission, is a good example of coinfections. It has been
proposed that malaria-induced immune activation may be associated with the
development of these lymphomas (Whittle et al., 1984).
The introduction of HIV-1 in the human population has altered the epidemi-
ology of several infectious diseases. A number of these organisms, termed to-
gether as opportunistic infectious agents, cause significant morbidity and mortal-
ity. HIV-1 is now a firmly established infectious agent and the potential to interact
with parasitic, viral, fungal, and bacterial infectious agents is very high.
The progression from HIV-1 infection to AIDS is associated with a decline
in the CD4 T-cell count and an increase in HIV-1 viral load. Although several
factors may be responsible for the variability in HIV-1 disease progression, im-
mune activation appears to be an important determinant. Immune activation leads
to up-regulation of viral co-receptors, decreased β chemokine secretion, enhanced
viral entry and integration, viral assembly and/or release of the viral particles,
changes in the cytokine environment and various degrees of immune dysfunc-
tion, hyporesponsiveness, and apoptosis. Because all systemic and/or local con-
current infections cause various degrees of immune activation, it is very likely
that they may enhance HIV infection, increase HIV replication and viral load,
and even promote progression of the disease.
Several studies have focused on the interaction between HIV/AIDS and three
major infectious diseases, namely malaria, sexually transmitted diseases (STDs),
and tuberculosis (TB) (Bentwich et al., 2000; Chandramohan and Greenwood,
1998). The main impact of STDs has been to facilitate HIV-1 transmission, and
the interaction of TB and HIV-1 has been an increase in the burden of an already
major cause of morbidity and mortality. As far as malaria is concerned, although
early studies did not reveal a definite interaction between malaria and HIV, there
is increasing evidence now that suggests these two pathogens interact, thus modi-
fying the pathogenesis of each disease (Bentwich et al., 2000; Chandramohan and
Greenwood, 1998; Corbett et al., 2002). This presentation will focus on the inter-
actions between HIV/AIDS and malaria.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

IMPLICATIONS FOR DEVELOPING COUNTRIES 127

Malaria, TB, and HIV/AIDS are important public health problems in sub-
Saharan Africa and some parts of Asia. Both HIV and malaria exert their heaviest
toll in sub-Saharan Africa, where the progression of HIV-related disease is con-
sidered to be most rapid. The interaction between HIV/AIDS and malaria can be
viewed in the mechanistic context, where immunomodulation by one organism
can impact the natural course of infection of the co-existing pathogen, and in
programmatic context, where the treatment for one disease may have beneficial
impact on the other disease and/or the treatment for one disease may not be effec-
tive in the presence of the co-infecting pathogen.
Initial studies of the interactions between HIV and malaria focused on the
ability of malaria parasites to act as opportunistic organisms in immunosuppressed
HIV-positive persons. As recent reviews demonstrate, most of the earlier studies,
conducted primarily in adults, did not show an effect of HIV infection on the
prevalence or severity of malaria (Chandramohan and Greenwood, 1998; Corbett
et al., 2002).
Earlier studies conducted in Zaire, Uganda, Rwanda, and Zambia, showed
no or marginal effect of HIV infection on malaria parasitemia (Simooya et al.,
1988; Chattopadhya et al., 1991; Greenberg, 1992). However, recent studies con-
ducted in Malawi reported increased prevalence rates of malaria parasitemia and
parasite density in HIV-infected pregnant women (Chandramohan and Green-
wood, 1998). The higher prevalence of malaria parasitemia was seen in HIV-
infected women of all gravidities, indicating that the parity-specific immunity to
malaria, which is normally associated with multigravidae, was impaired in HIV-
infected women (Chandramohan and Greenwood, 1998). More importantly, these
studies revealed that infants born to HIV- and malaria-positive mothers were at a
significantly higher risk for low birth weight. Increased prevalence of peripheral
parasitemia and placental malaria has also been seen in HIV-positive pregnant
women in western Kenya, which has higher rates of malaria transmission than
Malawi (Chandramohan and Greenwood, 1998). The increased prevalence of
parasitemia in HIV-positive women seemed to be pregnancy associated, because
parasitemia in HIV-positive women reduced to the level seen in HIV-negative
women 2–6 months postpartum.
HIV infection has been shown to induce poor responses to antimalarial treat-
ment with sulfadoxine-pyrimethamine (S/P) in pregnant women. A recent study
conducted in western Kenya indicated that although a standard two-dose S/P regi-
men worked well in controlling peripheral parasitemia and placental malaria dur-
ing pregnancy in HIV-negative women, it failed to prevent peripheral and placen-
tal parasitemia in HIV-infected women. Poor response to S/P antimalarial
treatment was also reported in pregnant Malawian women with HIV-1 infection.
Because parasitemia was reduced drastically after each treatment and monthly S/
P dosing worked well in both HIV-positive and HIV-negative women, it is pos-
sible that the poor treatment response was due to rapid re-infection rather than
delayed parasite clearance. No difference in quinine treatment failure was seen

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

128 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

between HIV-positive and HIV-negative children with malaria in Kinshasa, Zaire

(Chandramohan and Greenwood, 1998; Corbett et al., 2002).
Conflicting results have been reported about the effect of HIV infection on
malaria antibody responses in Plasmodium falciparum-endemic areas. Earlier
studies conducted in Zambia and India showed no differences between HIV-
positive and HIV-negative persons in terms of the prevalence of antimalarial
antibodies (Simooya et al., 1988; Chattopadhya et al., 1991). Very few HIV-
positive persons, however, were involved in these studies, and no attempts were
made to compare the titers of antibody response, although one did compare the
optical density (OD) (Chattopadhya et al., 1991).
In contrast, a study conducted in Uganda demonstrated consistent reduction
in mean OD of antibodies to synthetic peptides from the ring-infected erythrocyte
surface antigen (RESA) and circumsporozoite protein (CSP) of P. falciparum
and CSP of P. malariae. In addition, HIV-positive persons with AIDS had sig-
nificantly lower antibody levels (mean OD) of RESA antibodies than asymptom-
atic HIV-positive persons (Wabwire-Mangen et al., 1989). Cellular immune re-
sponses to malaria are seemingly also affected by HIV-1 infection. Compared
with HIV-negative persons, AIDS patients in Burkina Faso had lower prolifera-
tion of PBMCs to stimulation with merozoite surface protein-1 (MSP-1) and para-
site culture supernatant. They also had reduced in vitro production of IFN-γ and
IL-2. The immune suppression induced by HIV was probably general, because
PBMCs of AIDS patients also respond poorly to phytohaemagglutinin, tuberculin
purified protein derivative, and lipopolysaccharide (Migot et al., 1996).
We have recently evaluated the influence of HIV-1 on malaria antigen
specific antibody responses during pregnancy. These studies have revealed
that maternal and neonatal antibody levels against blood stage and sporozo-
ite stage antigenic determinants are significantly lower among HIV-infected
women compared with HIV-uninfected women. We also observed reduced
maternal-fetal transplacental antibody transfer in dually infected women. In
another recent study conducted in Kenya, we found elevated production of
IFN-γ by maternal placental (intervillous blood) mononuclear cells (IVBMC)
from multigravidae to be associated with protection against placental ma-
laria (Moore et al., 2000). A protective role for IFN-γ in controlling infection
has been demonstrated both in human studies and with animal models.
Mechanistically, this cytokine has been proposed to be important in mediat-
ing asexual blood-stage parasite clearance, perhaps via its regulatory influ-
ence on phagocytic cells. The importance of this cytokine in protection
against placental malaria is further supported by our recent finding that
IVBMC from HIV-positive women have impaired antigen-specific IFN-γ and
IL-4 responses (Moore et al., 2000). Since these cytokines are produced pri-
marily by T-cells, we conclude that this loss of cytokine responsiveness may
play a role in the increased susceptibility of HIV-positive women to placen-
tal malaria.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

IMPLICATIONS FOR DEVELOPING COUNTRIES 129

It has been suggested that the progression from HIV-1 infection to AIDS is
more rapid in sub-Saharan African patients than in persons living in developed
countries (Gilks, 1993; Mulder et al., 1994; Grant et al., 1997). In addition to the
lack of access to health care and treatment, chronic immune stimulation from
increased exposure to other infectious agents are probable co-factors of immune
activation. Earlier investigations of the relationship between HIV-1 and malaria
focused mainly on the effect of HIV-1 infection on malaria. Only one study ex-
amined the effect of malaria on HIV-1 infection, and failed to detect any effect of
malaria infection on HIV-1 progression. No measurements of changes in CD4+
T-cell counts and viral load, which are two current predictors of HIV disease
progression, were done in this study.
Recent in vitro and in vivo studies, nevertheless, indicate that malaria can
potentially affect the course of HIV infection in several aspects. The initial evi-
dence of a possible effect of malaria on HIV-1 infection came from a retrospec-
tive analysis of data from a cohort study of mothers and infants in rural Malawi. It
was demonstrated that infants born to mothers with both placental malaria and
HIV-1 infection had post-neonatal mortality 4.5 times higher than infants born to
mothers with only placental malaria, and 2.7–7.7 times higher than infants born
to mothers with only HIV-1 infection (Chandramohan and Greenwood, 1998;
Corbett et al., 2002). This increased mortality in infants born to mothers with dual
HIV and malaria was attributed to the increased transmission of HIV from mo-
thers to infants, although no HIV testing was conducted in these infants.
Because immune activation is an important prerequisite for efficient HIV
infection and viral replication, we evaluated the effect of malarial antigen stimu-
lation on HIV-1 infection. Stimulation with soluble malarial antigens or malarial
pigment from P. falciparum enhanced HIV-1 replication in PBMC from naive
donors by 10- to 100-fold. The malarial antigen-upregulated HIV-1 replication
was mediated through induction of TNF-α via the activation of long terminal
repeat (LTR)-directed viral transcription (Xiao et al., 1998). Preliminary studies
conducted with PBMC from HIV-positive individuals residing in western Kenya
indicated that recall immune responses induced by soluble malarial antigens can
increase HIV-1 replication (Xiao et al., unpublished observation). PBMC from 3
of 10 HIV-1 infected individuals showed active in vitro viral production after the
antigen stimulation.
These in vitro observations have been confirmed by the result of a recent
prospective, cohort study of 47 HIV-positive adults with active falciparum ma-
laria and 42 HIV-positive adults without malaria in Malawi. It was shown that
HIV-positive individuals with active malaria had a mean plasma HIV-1 viral load
7-fold higher than HIV-positive individuals without malaria (Hoffman et al.,
1999). Plasma HIV-1 RNA concentrations did not correlate significantly with P.
falciparum parasite density or the duration of fever. However, antimalarial che-
motherapy with S/P resulted in a small (37 percent) but significant reduction in

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

130 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

HIV-1 RNA load by week 4 post-treatment in individuals with HIV and malaria
coinfection.
Another potential interaction between HIV and malaria is at the invasion
stage of both pathogens. HIV-1 has been recently shown to bind erythrocytes
from Caucasian persons through the Duffy antigen receptor for chemokines
(DARC), a receptor that is also used by the invasion of P. vivax merozoites into
reticulocytes (Lachgar et al., 1998). It has been proposed that erythrocytes may
function as a reservoir for HIV-1, and this binding to CD4 (–) cells via DARC by
HIV may be used as a mechanism for the entry of HIV-1 into endothelial cells
and neurons (Lachgar et al., 1998). Because P. falciparum-infected erythrocytes
adhere to brain endothelial cells and cause brain hemorrhage, it is conceivable
that the sequestration of parasitized erythrocytes in the brain with HIV viral par-
ticles attached may facilitate the entry of HIV into neurons in individuals that are
DARC-positive. This may promote the occurrence of neurologic disorders, which
are frequently seen in AIDS patients.
Programmatic concerns for interactions between malaria and HIV/AIDS are
mainly at the level of diagnosis and treatment. Earlier diagnostic studies showed
false positivity of blood samples from malaria-affected individuals during HIV
testing (Biggar et al., 1996). This was probably due to nonspecificity of the early
HIV diagnostic kits, because antigen cross-reactivity between retroviruses and
malaria parasites has been reported (Lal et al., 1994). As far as treatment of un-
complicated and complicated malaria is concerned, blood transfusion for the treat-
ment of severe malarial anemia and presumptive treatment of febrile illness have
emerged as two important problems. Recent studies have shown that many of the
presumed malarial febrile illnesses were actually the result of primary HIV-1
infection (Nwanyanwu et al., 1997). This problem may be more severe in areas
with high prevalence of HIV and malaria, leading to unnecessary use of
antimalarials for the treatment of fever. This overuse of antimalarials may con-
tribute to the rapid emergence of drug resistance. As far as the transfusion-related
transmission of HIV is concerned, earlier studies clearly revealed that use of
unscreened blood for the treatment of severe malarial anemia was a factor in the
transmission of HIV.
While this paper provides an account of published work on the interaction
between malaria and HIV/AIDS, there is compelling evidence of interaction be-
tween other microorganisms and HIV/AIDS. It is likely that the interactions be-
tween several microorganisms present together in an individual may modulate
the pathogenesis and transmission of major infectious agents.
From a mechanistic point of view, however, a common thread that seems to
tie this interaction together is immune activation induced by infectious agents
prevalent in malaria-endemic areas. Therefore, removing risk factors of immune
activation (i.e., co-infectious agents) by effective use of drugs, physical interven-
tions to interrupt transmission, such as bednets for malaria, and other prevention
methods should have the dual effect of reduced risk of rapid progression of HIV-

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

IMPLICATIONS FOR DEVELOPING COUNTRIES 131

related disease (by elimination or suppression of viral activating factors) and re-
duced morbidity and mortality by a co-infecting pathogenic organism.
The schematics of our current knowledge and the likely outcomes of the
interaction between HIV and malaria are shown in Figure 2-1. It is very likely
that multiple enteric, respiratory, bloodborne, vectorborne, and waterborne and
foodborne agents may induce immunologic changes (even in asymptomatic in-
fections) that promote infection, transmission, and clinical manifestation of ill-
nesses of the co-infectious pathogens. It is therefore important to capture all mor-
bidity data and conduct extensive diagnostic work in future studies so that the
analysis can be controlled for the effect of different co-infectious agents.
In the context of HIV/AIDS and malaria, the available data should be consid-
ered in:

1. Promoting the development of and implementation of intervention guide-

lines and policies for prompt treatment of malaria with effective antimalarials;
treatment would reduce the frequency of malaria-related illness and reduce the
risk of rapid progression and transmission of HIV.
2. Incorporating prevention methods, such as the use of insecticide-impreg-
nated bednets and environmental modifications in controlling malaria transmis-
sion.
3. Implementing blood screening guidelines in anemia-related blood trans-
fusions.

Because of the increasing prevalence of major infectious diseases in many

countries, even a small impact of coinfection-mediated increase in pathogenesis
and transmission could have unparalleled human health consequences. There-
fore, from a global health perspective, there is a need to raise awareness at the
national level to the consequences of interactions of multiple infections in ma-
laria-endemic regions of the world. These efforts need to be complemented by
political commitment and funding at the national and international level for re-
search and disease control and prevention programs for infectious diseases in
malaria-endemic settings.

REFERENCES
Bentwich Z, Maartens G, Torten D, Lal AA, Lal RB. 2000. Concurrent infections and HIV pathogen-
esis. AIDS 14:2071–2081.
Biggar RJ, Miotti PG, Taha TE, Mtimavalye L, Broadhead R, Justesen A, Yellin F, Liomba G, Miley
W, Waters D, Chiphangwi JD, Goedert JJ. 1996. Perinatal intervention trial in Africa: effect of
a birth canal cleansing intervention to prevent HIV transmission. Lancet 347:1647–1650.
Chandramohan D and Greenwood BM. 1998. Is there an interaction between human immunodefi-
ciency virus and Plasmodium falciparum? International Journal of Epidemiology 27:296–301.
Chattopadhya D, Kumari S, Chatterjee R, Verghese T. 1991. Antimalarial antibody in relation to
seroreactivity for HIV infection in sera from blood donors. Journal of Communicable Diseases
23:195–198.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

132 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

Effect of HIV on Malaria

Pathogen
HIV
Target cell
Macrophage and CD4 and
dendritic cell CD8 T cell

Immunologic 1. Reduced production of NO 1. Reduced number of CD4

changes and other reactive oxygen T lymphocytes
intermediates and 2. Reduced T-helper
phagocytosis activity, cytotoxic T cell
2. Reduced antigen-presenting activity, antigen-driven
function IFN-γ production, and
3. Reduced antigen-dependent memory responses
cellular cytotoxicity 3. Exhaustion of certain T
(ADCC) activity cell repertoire clones
4. Production of 4. Polyclonal B cell
proinflammatory cytokines activation

Possible effect 1. Reduced antibody and cytokine responses because of

malarial infection
2. Reduced killing of malarial parasites
3. Fever associated with primary HIV infection masqueraded as
malaria

Likely outcome 1. Increased prevalence of peripheral malarial parasitema and

placental malaria
Mother
2. Reduced transfer of anti-malarial antibodies
3. Poor response to antimalarial prophylaxis
4. Misuse of antimalarials in the treatment of HIV-associated
fever

Infant 1. Increased susceptibility to malarial infection

2. Rapid reinfection by malarial parasites (decreased time to
reinfection)
3. Delayed development of antimalarial immunity
4. Increased severity of malaria
5. Poor response to antimalarial treatment

Adolescent 1. Loss of antimalarial immunity

2. Delayed clearance of malarial parasitemia
3. Increased occurrence of severe malarial anemia and cerebral
malaria

FIGURE 2-1 Current knowledge and likely outcomes of the interaction between HIV and
malaria.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

IMPLICATIONS FOR DEVELOPING COUNTRIES 133

Effect of Malaria on HIV

Pathogen
Malarial parasites
Target cell
Macrophage and CD4 and
dendritic cell CD8 T cell

Immunologic 1. Activation of monocytes 1. Activation of T

changes and dendritic cells lymphocytes
2. Production of 2. Immunosuppression
proinflammatory cytokines 3. Production of inflammatory
3. Upregulated expression of cytokines
chemokine receptors (HIV- 4. Upregulated expression of
coreceptors) chemokine receptors

Possible effect 1. Increased susceptibility of mononuclear cells to HIV infection

2. Increased viral replication in HIV-infected cells
3. Pathologic and immunologic changes in the placenta
4. Use of antimalarials, which are immunosuppressive and may
increase viral replication

Likely outcome
Mother 1. Increased HIV viral load
2. Increased vertical transmission of HIV
3. Lower birthweight of infants born from dually infected
mothers

Infant 1. Increased HIV transmission because of blood transfusion

2. Persistent, high HIV viral load
3. Possibility of increased HIV disease progression
4. Possibility of rapid death of HIV-infected infants

Adolescent 1. Possibility of increased HIV viral load

2. Possibility of accelerated HIV disease progression

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

134 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

Corbett EL, Steketee RW, ter Kuile FO, Latif AS, Kamali A, Hayes RJ. 2002. HIV-1/AIDS and the
control of other infectious diseases in Africa. Lancet 359:2177–2187.
Gilks CF. 1993. The clinical challenge of the HIV epidemic in the developing world. Lancet 342:1037–
1039.
Grant AD, Djomand G, De Cock KM. 1997. Natural history and spectrum of disease in adults with
HIV/AIDS in Africa. AIDS 11:S43–S54.
Greenberg AE. 1992. Pp. 143–148 in AIDS in the World, TW Netter, J Mann, DJM Tarantola, eds.
Boston: Harvard University Press.
Hoffman IF, Jere CS, Taylor TE, Munthali P, Dyer JR, Wirima JJ, Rogerson SJ, Kumwenda N, Eron
JJ, Fiscus SA, Chakraborty H, Taha TE, Cohen MS, Molyneux ME. 1999. The effect of Plasmo-
dium falciparum malaria on HIV-1 RNA blood plasma concentration. AIDS 13:487–494.
Lachgar A, Jaureguiberry G, Le Buenac H, Bizzini B, Zagury JF, Rappaport J, Zagury D. 1998.
Binding of HIV-1 to RBCs involves the Duffy antigen receptors for chemokines (DARC). Bio-
medicine and Pharmacotherapy 52:436–439.
Lal RB, Rudolph D, Alpers MP, Sulzer AJ, Shi YP, Lal AA. 1994. Immunologic cross-reactivity
between structural proteins of human T-cell lymphotropic virus type I and the blood stage of
Plasmodium falciparum. Clinical and Diagnostic Laboratory Immunology 1:5–10.
Migot F, Ouedraogo JB, Diallo J, Zampan H, Dubois B, Scott-Finnigan T, Sanou PT, Deloron P.
1996. Selected P. falciparum specific immune responses are maintained in AIDS adults in
Burkina Faso. Parasite Immunology 18:333–339.
Moore JM, Ayisi J, Nahlen BL, Misore A, Lal AA, Udhayakumar V. 2000. Immunity to placental
malaria. II. Placental antigen-specific cytokine responses are impaired in human immunodefi-
ciency virus-infected women. Journal of Infectious Diseases 182:960–964.
Mulder DW, Nunn AJ, Wagner HU, Kamali A, Kengeya-Kayondo JF. 1994. HIV-1 incidence and
HIV-1-associated mortality in a rural Ugandan population cohort. AIDS 8:87–92.
Nwanyanwu OC, Kumwenda N, Kazembe PN, Jemu S, Ziba C, Nkhoma WC, Redd SC. 1997. Ma-
laria and human immunodeficiency virus infection among male employees of a sugar estate in
Malawi. Transactions of the Royal Society of Tropical Medicine and Hygiene 91:567–569.
Simooya OO, Mwendapole RM, Siziya S, Fleming AF. 1988. Relation between falciparum malaria
and HIV seropositivity in Ndola, Zambia. British Medical Journal 297:30–31.
Wabwire-Mangen F, Shiff CJ, Vlahov D, Kline R, Serwadda D, Sewankambo NK, Mugerwa RD,
Quinn TC. 1989. Immunological effects of HIV-1 infection on the humoral response to malaria
in an African population. The American Journal of Tropical Medicine and Hygiene 41:504–511.
Whittle HC, Brown J, Marsh K, Greenwood BM, Seidelin P, Tighe H, Wedderburn L. 1984. T-cell
control of Epstein-Barr virus-infected B cells is lost during P. falciparum malaria. Nature
312:449–450.
Xiao L, Owen SM, Rudolph DL, Lal RB, Lal AA. 1998. Plasmodium falciparum antigen-induced
human immunodeficiency virus type 1 replication is mediated through induction of tumor ne-
crosis factor-alpha. Journal of Infectious Diseases 177:437–445.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

Obstacles and Opportunities for

Framing Future Research

OVERVIEW
Humans exist in complex milieus, and their association with disease is af-
fected both by the environment in which they live and by their genetic suscepti-
bility to particular diseases. People live in concert with microbial agents that may
or may not cause disease in particular individuals, depending on their environ-
ment and their genetics.
There are substantial obstacles to identifying organisms associated with a
particular chronic disease. First, organisms can act in a “hit and run” manner, in
which they cause disease initially but then are either resolved due to natural im-
munity or are successfully eliminated with antibiotics. The damage has been done,
however, resulting in chronic disease. For some chronic diseases of this type,
such as Reiter’s syndrome, Guillain-Barré syndrome, or rheumatic heart disease,
it is very difficult to find a fingerprint of the organism in the disease tissue. Sec-
ond, organisms can be latent at the time of diagnosis. They may not be actively
replicating, so there is no active RNA transcription. Third, chronic latent or recur-
rent infection may be involved in the pathogenesis so that, again, the organism
may not be active at the time of diagnosis. Fourth, organisms may need a particu-
lar predisposing environment or a host with a particular genetic susceptibility, so
the simple presence or absence of the organism may be misleading.
To address these problems, evidence is assembled in a number of ways: from
epidemiological studies, from microbiological assessment of pathogenesis and
etiology, from studies that mimic the disease process in vitro or in animals, and
from clinical treatment trials.

135

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

136 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

Patrick Moore described how the discovery of new pathogens will require
the talents of multiple disciplines, including epidemiology, clinical medicine,
molecular biology, and pathology. Moore used the example of the identification
of the virus that causes Kaposi’s sarcoma, which often strikes gay men, to discuss
general issues in causality and to illustrate the limits of current approaches for
determining causality for a newly discovered agent and disease. The causative
agent, named Kaposi’s sarcoma-associated herpesvirus (KSHV), was identified
using a genetic technique called representational difference analysis. Once the
virus was identified, in 1994, events moved rather quickly—a fact that speaks to
the importance of new pathogen discovery. The virus’s genome has been se-
quenced, serologic tests have been developed, and studies have been initiated to
understand its epidemiology and to test possible treatments. Moreover, the virus
has since been found to cause at least two other types of disease. Based on this
experience, Moore pointed to the need for researchers to move beyond Koch’s
postulates or other traditional guidelines in their efforts to determine disease cau-
sality for suspect microbes. Researchers are attempting to do this by applying
various new techniques emerging from molecular biology and biotechnology. It
seems clear as well that epidemiologists developing new criteria for causality will
have to incorporate new pathogenic mechanisms that are not accounted for in
current disease models.
Mikhail Pletnikov discussed the importance of expanding research to better
understand the interplay of genetic and environmental factors in the causation of
a number of important developmental behavioral disorders. Among methodologi-
cal problems of studying the gene-environment interplay is the difficulty in firmly
defining environmental factors and making them quantifiable. In this context,
virus infections provide a promising research avenue, because of their etiologic
connection to several neurodevelopmental disorders, including autism and schizo-
phrenia, and because of the reliability of quantification of viral effects on brain
and behavior. In particular, Pletnikov described work using an animal model to
study gene-environmental interactions that occur during neonatal infection with
Borna disease virus (BDV). Neonatal BDV infection in rats has been shown to
produce distinct neuroanatomical, neurochemical, and behavioral abnormalities
that resemble pathological and clinical features of some human developmental
disorders. The significance of studying neonatal exposure derives from the fact
that the effects of many genetic and environmental risk factors are evident either
prior to or around the time of birth, and the interaction between them often is
apparent well before the onset or diagnosis of the chronic disease condition. Thus,
studying the effects of neonatal BDV infection across the entire postnatal period
in genetically different strains of rats will aid in understanding the course and
time-dependent character of the interaction of genetic background features and
the virus infection. In this way, the model system may allow study of some tre-
mendously complex mechanisms relevant to developmental disorders.
David Persing provided an overview of recent research in the area of infec-

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

OBSTACLES AND OPPORTUNITIES FOR FRAMING FUTURE RESEARCH 137

tion, cancer, and the immune response. Current evidence suggests that inherited
predisposition to cancer probably accounts for only a subset of total cancer pa-
tients, and in most models of the development of neoplasia, an underlying as-
sumption is the contribution of an array of intrinsic and extrinsic factors within a
multistep process. A basic prerequisite of many models is an increase in the
baseline proliferation rates of essentially normal cell populations that leads to
dysregulation of normal growth control mechanisms. Since many infectious pro-
cesses often lead, directly or indirectly, to increased cell turnover and prolifera-
tion, certain agents are now widely regarded as carcinogens. Some of the patho-
gens that have been linked to cancer include human papillomaviruses (cervical
cancer and other skin cancers), human T-cell leukemia viruses (adult T-cell leu-
kemias and lymphomas in endemic areas), hepatitis B virus (liver cancer),
Epstein-Barr virus (Burkitt’s lymphoma and nasopharyngeal carcinoma), and
Helicobacter pylori infection (gastric carcinoma and MALT lymphoma).In addi-
tion, new disease associations are being made with respect to previously known
pathogens, such as the association of chronic hepatitis C virus infection with non-
Hodgkin’s lymphoma in certain populations.
In a separate presentation, Persing described recent and continuing advances
in the development and application of techniques for identifying pathogens that
cause chronic diseases. Although a paper on these subjects does not appear in this
chapter, the following paragraph notes the highlights.
The ability to detect and manipulate nucleic acid molecules in microorgan-
isms has created a powerful means for identifying previously unknown microbial
pathogens and for studying the host-pathogen relationship. Although a paper on
these subjects does not appear in the ensuing text, the highlights of his presenta-
tion are discussed here. Among the new technologies that Persing described is
broad-range polymerase chain reaction, which has proved instrumental in linking
a growing number of pathogens with chronic diseases, and representational dif-
ference analysis, which is an efficient means for finding differences between com-
plex genomes and for identifying specific DNA sequences from the genomes of
unknown pathogens. Researchers also are making use of sophisticated new DNA
microarrays and biosensors that, among other things, can monitor host response
as an indicator of the presence of infection or inflammation. In addition, new
methods for generating “libraries” of genetic information from very small
amounts of material are making it easier to conduct very specific and sensitive
serologic tests. Equipped with these and other advanced tools, researchers are
becoming better able to move beyond the limitations of Koch’s postulates and to
link infectious agents with chronic diseases more precisely and with greater con-
fidence than ever before.
In the ensuing discussions, participants began to sketch in some of the char-
acteristics of a comprehensive and coordinated effort that would enhance efforts
both to identify links between infectious microorganisms and chronic diseases
and to develop and implement interventions to minimize their health conse-

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

138 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

quences. The goal was not to set specific priorities, but to identify opportunities.
Highlighting a selection of the traits identified may provide a glimpse of the
overall picture envisioned.
Participants agreed, for example, on the need to develop standardized defini-
tions of infections and disease, to enable comparisons across studies and conclu-
sions about causality, and on the need to ensure that laboratory assays maintain
universally high standards of specificity, sensitivity, and reproducibility. New
laboratory technology also is needed that can meet such performance standards
while handling high throughput rates, in order to handle analyses of large cohorts
in a reasonable amount of time, a trait that likely will be required in many future
projects. Comparable efforts are needed to ensure that epidemiological studies
are conducted with vigor and in an appropriate manner. One step will involve
linking of databases that are designed (or modified) to be compatible. Peer review
journals can reinforce performance standards if publication depends on the use of
sound laboratory assays and epidemiologic design capable of supporting the con-
clusions.
Continued studies are needed to define temporal relationships between infec-
tions and disease—that is, what stage of infection determines outcome (e.g., first
infection, reinfection, persistent infection, coinfection, or subsequent cross-react-
ing infection). Studies also are needed to clarify at which stage infection must be
prevented or treated in order to minimize or eliminate chronic sequelae. It will be
important to determine the expected benefit of actions, to ensure that the benefits
will outweigh any possible risks. In other words, intervention should decrease
chronic disease burden without unduly endangering the people who receive care.
There is a need to better understand the natural history, especially the earliest
stages, of chronic diseases of unknown or incompletely known origins. What
makes this task especially important is the hit-and-run nature of some diseases in
which microbes set adverse events in motion and then disappear, the increased
difficulty of imputing causation to microbes detected late in the course of disease,
and the increased ease of treating or preventing disease at early time points. To-
ward this aim, clinicians should be increasingly encouraged to identify patients
who have recently developed or seem to be developing various suspect chronic
diseases, to collect in an orderly manner a range of clinical specimens, and then to
follow the course of the disease in order to identify tell-tale early clinical features.
Calls were made for more effort devoted to developing animal models of
chronic diseases, and to teaching health professionals about their value and their
limitations. Animal models can be powerful tools when the etiology or pathogen-
esis of a disorder is unknown. Psychiatric modeling with animals may present an
especially ripe area for probing a variety of important questions, yet many practi-
tioners in the field are not accustomed to working with such models.
Increased emphasis should be placed on longitudinal studies, as well as on
follow-up studies and “look back” studies of cohorts and surveillance results that
have been generated in the past. Longitudinal studies may prove particularly valu-

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

OBSTACLES AND OPPORTUNITIES FOR FRAMING FUTURE RESEARCH 139

able given that rapid advances in the field may mean that we might not know
today which pieces of evidence will be needed in the future. Human specimen
collections, such as the National Children’s Study that will begin in 2004, may be
especially important for longitudinal research.
Participants identified a number of specific populations that should receive
additional attention. One such group includes people who move from rural areas
into cities, both in the developing and the developed world. Studies are needed to
see whether they bring new infections with them, or whether they prove to be
susceptible to new infections that they previously had not encountered. With the
world’s changing demographics, gathering such information may provide a win-
dow into pathogenesis of a number of chronic diseases.
Efforts are needed to address problems related to informed consent. Many
workshop participants expressed concern that current regulations and guidelines
are too complex, too uncertain, or too restrictive to allow for meaningful sharing
of data—and sometimes all three. There was general agreement that informed
consent is and must remain an important part of research involving human sub-
jects. But participants also agreed that all parties—from government, academia,
and private funding agencies—need to work together to develop a more standard-
ized method for gaining patient consent, for gathering identifying information,
and for being able to use this identifying information in the future. This may be an
opportunity for multiple institutions and multiple governments, domestic and for-
eign, to cooperate in devising a system of patient consent that operates more
smoothly, protects patient rights, and allows for expanded research on infections
and chronic diseases.
Given the magnitude of the outstanding scientific questions, and of the health
consequences at stake, an increasing share of future research likely will involve
groups of investigators representing a variety of disciplines, or groups of institu-
tions working collaboratively. Although there remains a clear role for individual
investigators, it is becoming apparent that large multidisciplinary projects often
can best marshal the critical mass needed to address the thorniest biological prob-
lems. In many cases, these large projects will include a multinational component,
in order to ensure that sufficient attention is paid to multiracial, multiethnic, and
multicultural differences.
Participants called on the overall scientific community to evaluate whether it
is organized and structured properly to address these issues, and whether its vari-
ous components communicate effectively. The community also should mount a
concerted effort to identify gaps in current knowledge about the etiology of
chronic diseases, pinpoint what needs to be done to close those gaps, chart the
obstacles that stand in the way, and then identify and provide the necessary finan-
cial resources (monetary and human) to drive progress.
Government can play an important role by reorienting its funding priorities.
Indeed, the time is ripe. The government is now investing nearly $1 billion in
rebuilding the nation’s public health system, and part of the money will go to-

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

140 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

ward linking state health departments more closely with local health departments
than has historically been the case. At the same time, government research cen-
ters are launching major new interdisciplinary projects, and universities, which
often have been in competition with one another, are beginning to join in collabo-
rations. Thus, foundations are beginning to be built for bridges linking public
health, clinical medicine, and research. But these promising efforts need to be
nurtured to ensure continued cooperation.

PATHOGENS AND DISEASE:

ISSUES IN DETERMINING CAUSALITY
Patrick S. Moore
University of Pittsburgh
Pittsburgh, PA

Successful new pathogen discovery requires the talents of multiple disci-

plines, including epidemiology, clinical medicine, molecular biology, and pathol-
ogy. In this paper, the identification of Kaposi’s sarcoma-associated herpesvirus
(KSHV) illustrates general issues in causality and shows the limits on our ability
to determine a causality for a newly discovered agent and disease (Moore and
Chang, 1998).
The mysterious outbreak of Kaposi’s sarcoma among gay men was the har-
binger of the AIDS epidemic. It is now clear, however, that the AIDS-associated
Kaposi’s sarcoma epidemic was actually due to the collision of two independent
viruses in a susceptible population: HIV and a new virus, KSHV or HHV8, which
was found using molecular techniques (O’Brien et al., 1999).
Over 20 different agents had been put forward as the cause of KS before
1994. To look for the “KS agent” (Beral et al., 1990), Yuan Chang used represen-
tational difference analysis (RDA) to compare DNA from a Kaposi’s sarcoma
lesion to uninvolved, sterile-site tissue from the same patient on the assumption
that the two samples would be genetically identical except for the presence of the
putative agent’s genome (Chang et al., 1994).
As shown in Figure 3-1, RDA is a subtractive hybridization technique in
which PCR adapters are ligated onto digested DNA from the KS tissue (tester)
(Lisitsyn et al., 1993). The tester DNA was then rehybridized back to a ten-fold
excess of uninvolved sample DNA (driver) that had been identically digested.
For human genomic fragments present in the KS sample, 90 percent of these
fragments will form pairs with the corresponding antisense strand lacking the
adapter from the normal tissue DNA. PCR with a primer specific to this adapter
linearly amplifies these common sequences and, of course, there was no amplifi-
cation of the DNA rehybridized from the driver alone. Sequences that were unique
to the KS lesion, however, reanneal to each other and have adaptors on both ends,
so that amplification occurs exponentially. The initial PCR products are then

Copyright © National Academy of Sciences. All rights reserved.

Tissue from a Kaposis
Uninfected control tissue
sarcoma lesion

Isolate DNA. viral

DNA

Digest with restriction enzyme.

http://www.nap.edu/catalog/11026.html

Ligate PCR-adaptor sequence

only to infected tissue DNA
(tester).

TESTER (with adaptor) DRIVER (10x, no adaptor)

Hybridize tester DNA and
driver DNA together, with driver
in excess. mix, melt, anneal

Possible annealing patterns: (tester-tester hybrid) (tester-driver hybrid) (driver-driver hybrid)

PCR with adaptor-specific primers:

Copyright © National Academy of Sciences. All rights reserved.

Exponential amplification of Linear amplification of No amplification of
virus sequences human sequences human sequences
(tester-only hybrids; (tester-driver hybrids; (driver-only hybrids; no
adaptors at both ends) adaptor at one end) adaptors)

FIGURE 3-1 Representational differential analysis comparing DNA from a Kaposi’s sarcoma lesion to sterile-site tissue from the same patient.
141
The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

142 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

rehybridized again to the adapter-less healthy tissue DNA and the process is re-
peated, each time selectively enriching for the unique sequences found only in the
KS lesion (Gao and Moore, 1996).
Four RDA fragments were generated by this process, two of which were
found to be specific for the KS agent. Although these two fragments account for
less than 1 percent of the entire 145-kilobase viral genome, the few base-pairs
worth of unique information they provided made it possible to develop enough
tools to identify the agent.
The two fragments were used as Southern hybridization probes and tested
against KS lesions, showing that about three-quarters of the KS lesions were
positive for viral DNA. Using internal specific primers from the KS 330 band, a
PCR assay was developed that showed 25 out of 27, or 93 percent, of the initial
KS lesions tested positive. Moreover, the negative samples were equally telling:
one of the two negatives had degraded DNA and was not amplifiable by using
cellular primers, and the other one was mislabeled normal human kidney.
KSHV is a gamma herpesvirus belonging to the same class as Epstein-Barr
virus (EBV). It is associated with three different major proliferative diseases:
Kaposi’s sarcoma, primary effusion lymphoma (PEL) (Cesarman et al., 1995a), a
monoclonal B cell lymphoma, and multicentric Castleman’s disease (Soulier et
al., 1995), which is a polyclonal hyperplasia caused by a virus-encoded cytokine
expressed by KSHV (Parravicini et al., 1997). Nearly all KS and PEL patients
have KSHV infection, but only about half of HIV-negative, multicentric
Castleman’s disease patients are positive for KSHV infection indicating that this
disease has a heterogeneous pathogenesis.
The two aforementioned RDA fragments of the KSHV genome facilitated
the identification of infected cell lines to serve as source material for viral DNA
and as a reagent for biologic studies (Cesarman et al., 1995b). Genomic library
walking was performed using cosmid and lambda libraries from one of these cell
lines allowing sequencing of the remainder of the genome (Russo et al., 1996).
Using this information, various techniques were used to identify likely antigens
and generate serologic tests (Gao et al., 1996a,b; Kedes et al., 1996; Simpson et
al., 1996). While identification of high-titered infected cell lines sped up this
process, isolating the agent was not essential for developing tools to detect it.
Molecular biology has reached the point where it is straightforward to identify a
new agent, sequence its genome and develop serologic tests for it without ever
having actually purified, living sample of the agent. The virus does not have to be
grown in order to apply traditional techniques for determining whether or not an
agent is present.
The virus itself is a tremendously interesting scientific problem. It has a long
unique coding region containing all of the viral open reading frames. Unlike most
viruses, KSHV has pirated cellular genes over its evolution and the viral genes
are recognizable homologues to cellular genes of known function. Many of these

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

OBSTACLES AND OPPORTUNITIES FOR FRAMING FUTURE RESEARCH 143

genes provide new insights into tumor virology through their control of the cell
cycle, prevention of apoptosis, or immune evasion properties.
One might conclude that this virus is completely different from other viruses
and not much can be learned from it to extend to other viruses. In fact, the oppo-
site is true. EBV, for example, induces cellular cyclin D2 to drive the cell through
the G1/S cell cycle checkpoint; KSHV encodes its own version of a cyclin D with
an analogous function. Other examples of functional correspondence between the
KSHV homologues and viral genes encoded by even distantly related viruses can
be readily seen (Moore and Chang, 1998a, 2001). For this reason KSHV might be
considered something like a molecular Rosetta stone because by using it, we can
begin to interpret the language of molecular virology in terms of cell biology for
many different viruses.
The importance of new pathogen discovery is illustrated by a timeline of KS
research. This would be equally true also for hepatocellular carcinoma and hepa-
titis C or a wide range of diseases where a new pathogen has been found. The
point is that things change quite rapidly once the agent is finally found. Moritz
Kaposi initially described the disorder in 1873, but not until 70 years later was
there a suggestion of an infectious etiology. In 1981, the onset of the AIDS epi-
demic brought a tremendous increase in scientific interest in this cancer. There
was still, however, little known about the pathogenesis of this disorder in 1993
when there were over 200,000 cases of AIDS in the United States. At that time
over 20 different agents had been proposed at one time or another as the causal
agent for Kaposi’s sarcoma.
The description of KSHV was first published in 1994 and within two years
its viral genome was completely sequenced (Neipel et al., 1997; Russo et al.,
1996). By that time it was known that the virus was found in all forms of Kaposi’s
sarcoma (Boshoff et al., 1995; Chang et al., 1996; Moore and Chang, 1995),
serologic tests had been developed (Gao et al., 1996a,b; Kedes et al., 1996; Miller
et al., 1996; Simpson et al., 1996) and studies initiated to understand the epidemi-
ology of this virus in KS (Moore et al., 1996; Whitby et al., 1995). Shortly there-
after, studies were performed to see whether ganciclovir, a specific antiviral agent,
could be used to treat KS (Martin et al., 1999). At the present, there have been
over 2,000 papers published on KSHV and its role in malignancy.
Finding a new pathogen also can benefit other fields. When KSHV was first
described, only two other related rhadinoviruses had been described in new world
primates. Although we live in North America, humans are still considered old
world apes. One was herpesvirus saimiri from squirrel monkeys and the other
herpesvirus ateles from spider monkeys. Researchers at the University of Wash-
ington began to look for other primate KSHV-like viruses (Rose et al., 1997).
Using consensus PCR, two were found in rhesus macaques, and subsequently in
all the various branches of the primates, both lower and higher primates. This
suggests that the viral ancestor of KSHV evolved with us over time. Even more

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

144 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

interesting, another group found a closely-related but distinctly different virus in

rhesus macaques (Desrosiers et al., 1997). It was named rhesus rhadinovirus
(RRV) and belongs to a second lineage of rhadinoviruses. RRV was initially only
found in the lower primates, but last year an RRV was found in chimps (Greensill
et al., 2000; Lacoste et al., 2000; Lacoste et al., 2001). The implication is that
there is an ancestral KSHV/RRV-like virus split off in the primate evolution and
has followed through with the different primate lineages, probably including hu-
mans. Thus, it is almost certain that there is an undiscovered HHV 9.
An issue in new pathogen discovery is making the step from finding a new
DNA sequence to determining whether or not it causes a specific disease. Apply-
ing Koch’s postulates (Koch, 1942) can elucidate the process:

• The agent occurs in every case of disease.

• The agent never occurs as a fortuitous or non-pathogenic strain.
• The agent can be isolated from the lesion, grown in pure culture, induce
disease in a susceptible host and can be re-isolated from an infected susceptible host.

These were postulates that Koch developed for determining the cause of tu-
berculosis at a time when not much was known of viruses or the carrier state. This
was a brilliant attempt to develop a scientific rationale for determining whether
an agent is causal for disease or not.
Bradford Hill also developed epidemiologic criteria for causality which are
shown here for KSHV and KS (Hill, 1965). Though developed specifically for
cigarette smoking, most epidemiologists now use these criteria to determine
causality:

• Is the infection present in cases; do all types of the disease involve infec-
tion? Is it reproducible in multiple settings?
• Does infection precede disease?
• Is the infection specific to the disease or is it ubiquitous infection among
humans?
• Is the virus localized to the tumor (one interpretation of a biologic gradient)?
• Do the epidemiologic studies make sense (are they coherent?)?
• Is it biologically reasonable and do experiments confirm the relationship?

With regard to KSHV, the answers to these questions are largely true. KSHV
is present in more than 95 percent of KS lesions. It can be said that the remaining
negative 5 percent is probably spurious due to technical difficulties in detection
or misdiagnosis, and in fact the virus is absolutely necessary for disease. Though
this cannot be proven at present, it can be argued that the situation is very similar
to that of papillomavirus and cervical cancer 5 years ago. Is it generalizable? Yes.
All types of KS are infected as far as is known. It also appears to have the correct

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

OBSTACLES AND OPPORTUNITIES FOR FRAMING FUTURE RESEARCH 145

temporal association in that cohort studies show that patients are infected before
developing disease, and not afterwards.
But specificity is an important question. KSHV is not singly associated with
Kaposi’s sarcoma. It is also associated with two other diseases. However, the
epidemiology of these two diseases makes some sense in terms of Kaposi’s sar-
coma, so multiple outcomes are not too worrisome. Depending on the assay that
is used, some researchers suggest that the infection rate in the general population
for this virus is much higher than alluded to here, but careful studies suggest that
less that 5 percent of Americans are infected with KSHV.
Is there a biologic gradient? Yes, there is. Are the epidemiologic findings
coherent? Yes, a wide range of epidemiologic studies seem to come to exactly the
same set of conclusions. Is it biologically plausible? Yes, there are multiple
oncogenes in this virus, related viruses cause cancers, and there are blinded clini-
cal trials which seem to suggest that treatment with ganciclovir prevents the de-
velopment of Kaposi’s sarcoma.
KSHV and KS was a relatively easy case even though it took two years and
seven or eight different studies before these conclusions could be reached. None-
theless, the case for causality was relatively easy.
Now let’s consider issues where causality is more problematic. First, KSHV
has been claimed not only to cause Kaposi’s sarcoma, but also a wide variety of
diseases that don’t fit its epidemiologic pattern, such as multiple myeloma and
sarcoidosis. Although studies supporting these associations were published in
reputable journals, they were based on PCR or had other problems and remain
questionable in terms of contemporary epidemiological knowledge. In the age of
PCR, it is difficult for the casual observer to sort out what is true and what is not.
Assuming that the problem of poor laboratory technique can be solved, there
are three more fundamental problems in determining causality. First, causality is
relative and should not be thought of as being cast in stone. Causality depends on
pathogenic assumptions. That is where Koch’s postulates fall down and also
where Hill’s criteria fall down as well.
For example, if a virus is associated with autoimmune disorders, it can be
assumed that one would have an immune response against that virus. In that case
the individual may actually clear the virus, so a reverse association would be seen
from what would normally be expected following Hill’s criteria. The criteria sim-
ply do not apply in this case, even though it is a reasonable possibility.
Second, causality is normative. Researchers can get together and study the
data but only a few agree to particular conclusions. When the studies describing
KSHV as the cause of KS were completed, it was thought that the issue of causal-
ity would be resolved. However, it still required a great deal of interpretation.
There were many contradictory studies that were ignored because they were not
considered valid. But others might disagree, and this is true for just about any
contentious issue. An agent is only considered causal for a disease when a major-

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

146 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

ity of scientists agree and it is passed on as received wisdom to others. By then,

few scientists probably know the actual studies that were actually used to deter-
mine causality.
Third, no agent causes disease alone. There are some fairly convincing ex-
amples, HIV as well as rabies virus. Simply not enough is understood about the
epidemiology of rabies virus to know whether or not there are people who have
been exposed to it who have not developed disease. But with the possible excep-
tion of those two viruses, virtually every other infection can have a symptomatic
infection, and disease is determined by other factors than the virus alone.
There are several examples where current methods of determining causality
break down. One is the role of EBV in nasopharyngeal carcinoma (NPC). There
is extremely strong evidence that EBV is the cause of nasopharyngeal carcinoma,
but EBV is a near ubiquitous infection. So Hill’s criteria cannot be used to deter-
mine that EBV causes nasopharyngeal carcinoma since it is likely to be a com-
posite risk factor and additional causal factors have to be used in conjunction
with EBV infection. These factors are unknown for NPC, but it is easy to see that
rather than using EBV infection alone as an exposure variable, it may be more
valuable to measure exposure as EBV infection at a certain susceptible age or
EBV infection in a cell having a specific mutation.
EBV and NPC shows another problem with Hill’s criteria for causality. Raab-
Traub developed an assay for EBV terminal repeat monoclonality and using this
assay found that in NPC tumors, the precursor cell forming the monoclonal tumor
was infected with a monoclonal form of the virus (Raab-Traub and Flynn, 1986).
For molecular biologists and virologists, this is overwhelming proof that the virus
causes the tumor since the odds of this happening by chance are so small. It is
extremely unlikely that a healthy cell was first infected with the virus, and by
chance the same cell independently became transformed into an expanding tumor
cell population with EBV growing inside of it as a passenger virus. However, this
does not neatly fit Hill’s criteria and epidemiologists have no way of weighing
the importance of this “overwhelming” piece of molecular evidence, especially in
comparison to contradicting evidence such as the ubiquity of EBV infection
among humans.
Multicentric Castleman’s disease (MCD) illustrates additional problems re-
lated to determining causality for different diseases which look identical. About
half of MCD tumors are positive for KSHV and so it seems that there are actually
two diseases, not just one, under the label of MCD. KSHV is only considered
necessary for the KSHV positive form. Now that it is known what to look for,
there may be subtle clinical and pathologic clues that can distinguish the two
forms of MCD. Analogous situations can be drawn for hepatocellular carcinoma
and hepatitis virus C positive hepatocellular carcinoma, or for meningitis and any
of the many causes of meningitis. While hepatitis virus C is not necessary for all
liver cancers, it is obviously necessary for hepatitis virus C positive tumors. By
defining a subset of diseases associated with a viral infection post-hoc, the cau-

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

OBSTACLES AND OPPORTUNITIES FOR FRAMING FUTURE RESEARCH 147

sality argument becomes circular even though we now have good reasons for
splitting up a disease manifestation into different diseases with different manifes-
tations.
It is likely that in the future, improved knowledge of pathogenic mechanisms
will reveal novel causal relationships. For example, not too long ago the idea that
a bacteria could cause stomach ulcers would have been considered laughable.
Helicobacter pylori and peptic ulcer disease had a pathogenic mechanism that
was poorly understood and thus there was no framework to gauge whether or not
a bacteria was the possible cause. In fact, pathologists had seen bacteria associ-
ated with ulcers for decades but didn’t remark on them because there was no way
to measure their significance.
New ways of determining causality that go beyond Hill’s criteria and Koch’s
postulates need to be developed if new and complex mechanisms for disease are
to be understood. Researchers have attempted to do this by taking into consider-
ation new techniques of molecular biology (Fredericks and Relman, 1996). It
seems clear that epidemiologists developing new criteria for causality will have
to incorporate new pathogenic mechanisms that are not currently accounted for.
Unfortunately, no one can predict what new pathogenic mechanisms will be
discovered and therefore there are no universal criteria for causality that will not
need future revisions. In the end, it cannot be absolutely proved that an agent
causes disease, only that it does not. Instead, while criteria such as Hill’s or Koch’s
postulates are enormously helpful in guiding our thinking, we should not be con-
strained by them as has happened in cases like EBV and nasopharyngeal carci-
noma. In this case, both science and public health have suffered from rigid adher-
ence to abstract criteria. For cases where established criteria break down, all that
can be done is to develop a detailed pathogenic model which can be tested using
epidemiologic studies and further modified. In essence, to use the scientific
method which is employed by scientists every day.

REFERENCES
Beral V, Peterman TA, Berkelman RL, Jaffe HW. 1990. Kaposi’s sarcoma among persons with AIDS:
a sexually transmitted infection? Lancet 335:123–128.
Boshoff C, Whitby D, Hatziioannou T, Fisher C, van der Walt J, Hatzakis A, Weiss R, Schulz T.
1995. Kaposi’s sarcoma-associated herpesvirus in HIV-negative Kaposi’s sarcoma. Lancet
345:1043–1044
Cesarman E, Chang Y, Moore PS, Said JW, Knowles DM. 1995a. Kaposi’s sarcoma-associated her-
pesvirus-like DNA sequences in AIDS-related body-cavity-based lymphomas. New England
Journal of Medicine 332:1186–1191.
Cesarman E, Moore PS, Rao PH, Inghirami G, Knowles DM, Chang Y. 1995b. In vitro establishment
and characterization of two acquired immunodeficiency syndrome-related lymphoma cell lines
(BC-1 and BC-2) containing Kaposi’s sarcoma-associated herpesvirus-like (KSHV) DNA se-
quences. Blood 86:2708–2714.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

148 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

Chang Y, Cesarman E, Pessin MS, Lee F, Culpepper J, Knowles DM, Moore PS. 1994. Identification
of herpesvirus-like DNA sequences in AIDS-associated Kaposi’s sarcoma. Science 265:1865–
1869.
Chang Y, Ziegler JL, Wabinga H, Katongole-Mbidde E, Boshoff C, Schulz T, Whitby D, Maddalena
D, Jaffe HW, Weiss RA, Moore PS. 1996. Kaposi’s sarcoma-associated herpesvirus and
Kaposi’s sarcoma in Africa. Archives of Internal Medicine 156:202–204.
Desrosiers RC, Sasseville VG, Czajak SC, Zhang X, Mansfield KG, Kaur A, Johnson RP, Lackner
AA, Jung JU. 1997. A herpesvirus of rhesus monkeys related to the human Kaposi sarcoma-
associated herpesvirus. Journal of Virology 71:9764–9769.
Fredericks DN and Relman DA. 1996. Sequence-based identification of microbial pathogens: A re-
consideration of Koch’s postulates. Clinical Microbiology Reviews 9:18–33.
Gao SJ and Moore PS. 1996. Molecular approaches to the identification of unculturable infectious
agents. Emerging Infectious Diseases 2:159–167.
Gao SJ, Kingsley L, Hoover DR, Spira TJ, Rinaldo CR, Saah A, Phair J, Detels R, Parry P, Chang Y,
Moore PS. 1996a. Seroconversion to antibodies against Kaposi’s sarcoma-associated herpesvi-
rus-related latent nuclear antigens before the development of Kaposi’s sarcoma. New England
Journal of Medicine 335:233–241.
Gao SJ, Kingsley L, Li M, Zheng W, Parravicini C, Ziegler J, Newton R, Rinaldo CR, Saah A, Phair
J, Detels R, Chang Y, Moore PS. 1996b. KSHV antibodies among Americans, Italians and
Ugandans with and without Kaposi’s sarcoma. Nature Medicine 2:925–928.
Greensill J, Sheldon JA, Murthy KK, Bessonette JS, Beer BE, Schulz TF. 2000. A chimpanzee
rhadinovirus sequence related to Kaposi’s sarcoma-associated herpesvirus/human herpesvirus
8: increased detection after HIV-1 infection in the absence of disease. AIDS 14:F129–135.
Hill AB. 1965. Environment and disease: association or causation? Proceedings of the Royal Society
of Medicine 58:295–300.
Kedes DH, Operskalski E, Busch M, Kohn R, Flood J, Ganem D. 1996. The seroepidemiology of
human herpesvirus 8 (Kaposi’s sarcoma-associated herpesvirus): distribution of infection in KS
risk groups and evidence for sexual transmission. Nature Medicine 2:918–924.
Koch R. 1942. The aetiology of tuberculosis (translation of Die Aetiologie der Tuberculose [1882]).
Pp. 392–406 in Source Book of Medical History, DH Clark, ed. New York: Dover Publications,
Inc.
Lacoste V, Mauclere P, Dubreuil G, Lewis J, Georges-Courbot MC, Gessain A. 2000. KSHV-like
herpesviruses in chimps and gorillas. Nature 407:151–152.
Lacoste V, Mauclere P, Dubreuil G, Lewis J, Georges-Courbot MC, Gessain A. 2001. A novel gamma
2-herpesvirus of the Rhadinovirus 2 lineage in chimpanzees. Genome Research 11:1511–1519.
Lisitsyn NA, Rosenberg MV, Launer GA, Wagner LL, Potapov VK, Kolesnik TB, Sverdlov ED.
1993. A method for isolation of sequences missing in one of two related genomes.
Molekuliarnaia Genetika, Mikrobiologiia, i Virusologiia 3:26–9
Martin DF, Kuppermann BD, Wolitz RA, Palestine AG, Li H, Robinson CA. 1999. Oral ganciclovir
for patients with cytomegalovirus retinitis treated with a ganciclovir implant. New England
Journal of Medicine 340:1063–1070.
Miller G, Rigsby MO, Heston L, Grogan E, Sun R, Metroka C, Levy JA, Gao SJ, Chang Y, Moore P.
1996. Antibodies to butyrate-inducible antigens of Kaposi’s sarcoma-associated herpesvirus in
patients with HIV-1 infection. New England Journal of Medicine 334:1292–1297.
Moore PS and Chang Y. 1995. Detection of herpesvirus-like DNA sequences in Kaposi’s sarcoma
lesions from persons with and without HIV infection. New England Journal of Medicine
332:1181–1185.
Moore PS and Chang Y. 1998a. Antiviral activity of tumor-suppressor pathways: clues from molecu-
lar piracy by KSHV. Trends in Genetics 14:144–150.
Moore PS and Chang Y. 1998b. The discovery of KSHV (HHV 8). Epstein-Barr Virus Report 5:1–3.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

OBSTACLES AND OPPORTUNITIES FOR FRAMING FUTURE RESEARCH 149

Moore PS and Chang Y. 2001. Kaposi’s sarcoma-associated herpesvirus. Pp. 2803–2833 in Fields
Virology, DM Knipe and P Howley, eds. Philadelphia: Lippincott, Williams & Wilkins.
Moore PS, Kingsley LA, Holmberg SD, Spira T, Gupta P, Hoover DR, Parry JP, Conley LJ, Jaffe
HW, Chang Y. 1996. Kaposi’s sarcoma-associated herpesvirus infection prior to onset of
Kaposi’s sarcoma. AIDS 10:175–180.
Neipel F, Albrecht JC, Fleckenstein B. 1997. Cell-homologous genes in the Kaposi’s sarcoma-asso-
ciated rhadinovirus human herpesvirus 8: determinants of its pathogenicity?. [Review]. Journal
of Virology 71:4187–4192.
O’Brien TR, Kedes D, Ganem D, Macrae DR, Rosenberg PS, Molden J, Goedert JJ. 1999. Evidence
for concurrent epidemics of human herpesvirus 8 and human immunodeficiency virus type 1 in
US homosexual men: rates, risk factors, and relationship to Kaposi’s sarcoma. Journal of Infec-
tious Diseases 180:1010–1017.
Parravinci C, Corbellino M, Paulli M, Magrini U, Lazzarino M, Moore PS, Chang Y. 1997. Expres-
sion of a virus-derived cytokine, KSHV vIL-6, in HIV-seronegative Castleman’s disease. Ameri-
can Journal of Pathology 151:1517–1522.
Raab-Traub N and Flynn K. 1986. The structure of the termini of the Epstein-Barr virus as a marker
of clonal cellular proliferation. Cell 47:883–889.
Rose TM, Strand KB, Schultz ER, Schaefer G, Rankin GW Jr, Thouless ME, Tsai CC, Bosch ML.
1997. Identification of two homologs of the Kaposi’s sarcoma-associated herpesvirus (human
herpesvirus 8) in retroperitoneal fibromatosis of different macaque species. Journal of Virology
71:4138–4144.
Russo JJ, Bohenzky RA, Chien MC, Chen J, Yan M, Maddalena D, Parry JP, Peruzzi D, Edelman IS,
Chang Y, Moore PS. 1996. Nucleotide sequence of the Kaposi sarcoma-associated herpesvirus
(HHV8). Proceedings of the National Academy of Sciences 93:14862–14867.
Simpson GR, Schulz TF, Whitby D, Cook PM, Boshoff C, Rainbow L, Howard MR, Gao SJ,
Bohenzky RA, Simmonds P, Lee C, de Ruiter A, Hatzakis A, Tedder RS, Weller IV, Weiss RA,
Moore PS. 1996. Prevalence of Kaposi’s sarcoma associated herpesvirus infection measured by
antibodies to recombinant capsid protein and latent immunofluorescence antigen. Lancet
348:1133–1138.
Soulier J, Grollet L, Oksenhendler E, Cacoub P, Cazals-Hatem D, Babinet P, d’Agay MF, Clauvel JP,
Raphael M, Degos L. 1995. Kaposi’s sarcoma-associated herpesvirus-like DNA sequences in
multicentric Castleman’s disease. Blood 86:1276–1280.
Whitby D, Howard MR, Tenant-Flowers M, Brink NS, Copas A, Boshoff C, Hatzioannou T, Suggett
FE, Aldam DM, Denton AS, et al. 1995. Detection of Kaposi’s sarcoma-associated herpesvirus
(KSHV) in peripheral blood of HIV-infected individuals predicts progression to Kaposi’s sar-
coma. Lancet 364:799–802.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

150 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

EXPLORING THE GENETIC BACKGROUND–ENVIRONMENT

INTERPLAY IN AN ANIMAL MODEL OF NEURODEVELOPMENTAL
DISORDERS: A MULTIDISCIPLINARY APPROACH
Mikhail V. Pletnikov, M.D., Ph.D.*
Departments of Psychiatry and Behavioral Sciences, Johns Hopkins University
School of Medicine, Baltimore, MD
and
Laboratory of Pediatric and Respiratory Viral Diseases, Center for Biologics
Evaluation and Research, U.S. Food and Drug Administration, Bethesda, MD

Data from family, twin, and adoption studies convincingly show evidence of
a substantial genetic contribution to most neurodevelopmental disorders in hu-
mans. Moreover, recent improvements in molecular and genetic technologies have
resulted in the implication of genes at several chromosomal loci and a search for
candidate genes continues. However, multiple examples of deviation of complex
developmental disorders from clear-cut Mendelian transmission cannot be fully
explained by incomplete penetrance, variable expressivity, or polygenic etiology.
A growing body of evidence suggests an important role of environmental factors
in the causation of some developmental behavioral disorders. Unfortunately, en-
vironmental studies have been carried out with the same concept in mind, i.e., a
search for relevant risk factors that would be self-sufficient to explain the patho-
genesis of human conditions. Very little, if any, theoretical or methodological
interaction between genetic linkage analysis and environmental (e.g., toxicology
or teratology) studies has been undertaken. However, it is the gene-environment
interaction that determines variable disease outcomes and responses to treatment
and must be addressed in future research approaches.
Although it is clear that there are critical interactions between genes and
environment to produce disease phenotypes, this concept has not been a focus of
extensive consideration that the important role of environmental factors becomes
more apparent in the setting of interaction with genetic determinants. Separating
the search for genetic determinants vs. environmental disease etiologies was, in
part, based on the assumption that genes and environmental sources are mainly
additive in their effects, with the outcome reflecting the sum of their influences.
However, the evidence is now clear that genes and environment are interactive as
well, and several important issues of the gene-environment interaction are illus-
trated here with data obtained on the animal model of neurodevelopmental dam-
age in rats neonatally infected with an experimental teratogen, Borna disease
virus (BDV).
Among methodological problems of studying the gene-environment inter-
play is the difficulty in firmly defining environmental factors and making them

*This work was supported by the National Institutes of Health, grant 2RO1 MH 48948-08A1.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

OBSTACLES AND OPPORTUNITIES FOR FRAMING FUTURE RESEARCH 151

quantifiable. In this context, virus infections provide a promising research avenue

because of their clear etiologic connection to several human neurodevelopmental
disorders and because of reliability of quantification of viral effects on brain and
behavior (Johnson, 1998). For example, in the BDV model, neonatal infection of
the rat’s brain with this 8.9-kb non-segmented, negative-strand, enveloped RNA
virus (Briese et al., 1994; Cubitt et al., 1994) produces distinct neuroanatomical,
neurochemical and behavioral abnormalities that resemble pathological and clini-
cal features of human developmental disorders (Carbone et al., 1991; Carbone
and Pletnikov, 2000; Bautista et al., 1994, 1995; Dittrich et al., 1989; Pletnikov et
al., 1999, 2000, 2001; Hornig et al., 1999; Eisenman et al., 1999; Gonzalez-Dunia
et al., 2000; Weissenbock et al., 2000).
Considering gene-environmental interaction may also help us to better un-
derstand the nature of some environmental risk factors. For example, in adult
infected Lewis rats, BDV-induced brain damage is primarily mediated by T-cell
inflammatory response, causing generalized encephalitis and meningitis (Narayan
et al., 1983; Hirano et al., 1983). This global damage significantly hampers stud-
ies of other pathogenic mechanisms of viral neurotoxicity. In contrast, in differ-
ent genetic settings (e.g., black hooded rats or tree shrews), adult BDV infection
does not appear to evoke significant inflammatory response, providing new in-
sights into the mechanisms of chronic BDV-associated neurobehavioral deficits
(Herzog et al., 1991; Sprankel et al., 1978).
Similar methodological advantages are demonstrated by neonatal rat BDV
infection serving as an animal model of neurodevelopmental damage, while also
emphasizing a neurodevelopmental perspective in studying the gene-environment
interaction. The significance of the neurodevelopmental perspective is substanti-
ated by the fact that effects of many genetic and environmental risk factors are
evident either prior to or around the time of birth, and the interaction between
them is apparent well before the identified onset/diagnosis of the classical, chronic
disease condition. For this reason, we study effects of neonatal BDV infection
across the entire postnatal period in genetically different strains of rats in order to
understand the course and time-dependent character of the interaction of genetic
background features and the virus infection.
In the newer view on the gene-environment interaction, wherein environ-
mental factors are considered to have variable effects on individuals with differ-
ent genotypes, gene-environment interactions result from genetically-mediated
differences in sensitivity to environmental factors. This issue clearly underlines a
need for searching for genes that mediate susceptibility to environmental factors
rather than genes that directly determine specific chronic conditions. From a
pathogenesis point of view, if environmental effects are mainly observed in vul-
nerable individuals, there is also a need in understanding what pathogenic role
individual characteristics may play in modulating differential responses to the
environment, variable disease outcome, and sensitivity to treatments. Obviously,
such studies must be complex and multidisciplinary, simultaneously addressing

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

152 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

alterations in brain structure, chemistry, endocrine function and behaviors in ge-

netically different settings.
Here, using our BDV neonatal rat model of neurodevelopmental damage, we
present the data of the developmental analysis of the pathogenic role of baseline
(i.e., strain-related) differences in physiology, neurochemistry, and behaviors be-
tween two inbred rat strains, Lewis and Fisher344 rats in determining BDV-in-
duced (i) brain damage, (ii) alterations in monoamine systems, (iii) behavioral
deficits, and (iv) responses to pharmacological treatment.
Our data show that basic virus infection in both strains is comparable, e.g.,
similar virus replication and distribution in brain parenchyma in BDV-infected
Fisher344 and Lewis rats throughout the postnatal period and similar inhibition
of body weight gain in both rat strains. However, the outcome of this virus infec-
tion in these two different strains is not identical. Neonatal BDV infection pro-
duces a more profound thinning of the neocortex in Fisher344 rats compared to
Lewis rats, while a similar reduction in granule cells in the dentate gyrus of the
hippocampus and the comparable hypoplasia of the cerebellum was observed in
two rat strains (Pletnikov et al., 2002a).
Neurochemical studies indicated regional and strain-specific monoamine al-
terations in tissue content, turnover and density of post- and presynaptic receptors
in developing and adult BDV-infected Lewis and Fisher344 rats at postnatal day
(PND) 30 and 120.
The observed strain-specific brain pathology and neurochemical alterations
may explain differential behavioral deficits and responses to ameliorative phar-
macological treatments in BDV-infected Lewis and Fisher344 rats. For example,
when assessed by the prepulse inhibition of the acoustic startle paradigm, neona-
tal BDV infection impaired sensorimotor gating in Fisher344 but not in Lewis
rats at PND 30 and 120 (Pletnikov et al., 2002a). Also, neonatal BDV infection
produced greater hyperactivity in Fisher344 rats compared to Lewis rats. The
difference in hyperactivity was especially evident at PND 30.
Effects of the interaction of genetic background and environmental insult
were further observed in responses of diseased animals to ameliorative pharma-
cological treatments. Novelty-induced hyperactivity remained unaffected by in-
jections of a serotonin (5-HT) A1 receptors agonist 8-OH-DPAT in BDV-in-
fected Lewis rats, while 8-OH-DPAT significantly decreased novelty-induced
hyperactivity in BDV-infected Fisher344 rats. In contrast, novelty-induced hy-
peractivity was significantly depressed by a selective serotonin reuptake inhibitor
(SSRI), fluoxetine, in BDV-infected Lewis rats and remained unaffected in BDV-
infected Fisher344 rats (Pletnikov et al., 2002b).
In conclusion, it is likely that the interaction between genetic background
and environmental insult contributes to the variability seen in chronic human
conditions. The specific mechanisms and processes involved in the genotype-
environment interaction remain largely unknown and are only just beginning to
be explored. In the present work, some theoretical and methodological aspects of

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

OBSTACLES AND OPPORTUNITIES FOR FRAMING FUTURE RESEARCH 153

the gene-environmental interaction are discussed and illustrated with the data
from the analysis of effects of different genetic background on neurodevelop-
mental damage and responses to treatment in two rat strains following the neona-
tal BDV infection.

REFERENCES
Bautista JR, Schwartz GJ, de la Torre JC, Moran TH, Carbone KM. 1994. Early and persistent abnor-
malities in rats with neonatally acquired Borna disease virus infection. Brain Research Bulletin
34:31–40.
Bautista JR, Rubin SA, Moran TH, Schwartz GJ, Carbone KM. 1995. Developmental injury to the
cerebellum following perinatal Borna disease virus infection. Brain Research. Developmental
Brain Research 90:45–53.
Briese T, Schneemann A, Lewis AJ, Park YS, Kim S, Ludwig H, Lipkin WI. 1994. Genomic organi-
zation of Borna disease virus. Proceedings of the National Academy of Sciences 91:4362–4366.
Carbone K and Pletnikov M. 2000. Borna again, starting from the beginning. Molecular Psychiatry
5:577.
Carbone KM, Park SW, Rubin SA, Waltrip RW II, Vogelsang GB. 1991. Borna disease: association
with a maturation defect in the cellular immune response. Journal of Virology 65:6154–6164.
Cubitt B, Oldstone M, de la Torre JC. 1994. Sequence and genome organization of Borna disease
virus. Journal of Virology 68:1382–1396.
Dittrich W, Bode L, Kao M, Schneider K. 1989. Learning deficiencies in Borna disease virus-infected
but clinically healthy rats. Biological Psychiatry 26:818–828.
Eisenman LM, Brothers R, Tran MH, Kean RB, Dickson GM, Dietzschold B, Hooper DC. 1999.
Neonatal Borna disease virus infection in the rat causes a loss of Purkinje cells in the cerebel-
lum. Journal of Neurovirology 5:181–189.
Gonzalez-Dunia DM, Watanabe S, Syan M, Mallory E, de la Torre JC. 2000. Synaptic pathology in
Borna disease virus persistent infection. Journal of Virology 74:3341–3448.
Herzog S, Frese K, Rott R. 1991. Studies on the genetic control of resistance of black hooded rats to
Borna disease. Journal of General Virology 72:535–540.
Hirano N, Kao M, Ludwig H. 1983. Persistent, tolerant or subacute infection in Borna disease virus-
infected rats. Journal of General Virology 64:1521–1530.
Hornig M, Weissenbock H, Horscroft N, Lipkin WI. 1999. An infection-based model of
neurodevelopmental damage. Proceedings of the National Academy of Sciences 96:12102–
12107.
Johnson RT. 1998. Viral infections of the nervous system. Philadelphia: Lippincott-Raven.
Narayan OS, Herzog K, Frese H, Rott R. 1983. Behavioral disease in rats caused by immunopatho-
logical responses to persistent Borna virus in the brain. Science 220:1401–1403.
Pletnikov MV, Rubin SA, Vasudevan K, Moran TH, Carbone KM. 1999. Developmental brain injury
associated with abnormal play behavior in neonatally Borna Disease Virus (BDV)-infected
Lewis rats: A model of autism. Behavorial Brain Research 100:30–45.
Pletnikov MV, Rubin SA, Schwartz GJ, Carbone KM, Moran TH. 2000. Effects of neonatal rat Borna
disease virus (BDV) infection on the postnatal development of monoaminergic brain systems.
Brain Research. Developmental Brain Research 119:179–185.
Pletnikov MV, Rubin SA, Carbone KM, Moran TH, Schwartz GJ. 2001. Neonatal Borna disease virus
infection (BDV)-induced damage to the cerebellum is associated with sensorimotor deficits in
developing Lewis rats infection on the postnatal development of monoaminergic brain systems.
Brain Research. Developmental Brain Research 126:1–12.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

154 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

Pletnikov MV, Rubin SA, Vogel MW, Moran TH, Carbone KM. 2002a. Effects of genetic back-
ground on neonatal Borna disease virus infection-induced neurodevelopmental damage. I. Brain
pathology and behavioral deficits. Brain Research 944:97–107.
Pletnikov MV, Rubin SA, Vogel MW, Moran TH, Carbone KM. 2002b. Effects of genetic back-
ground on neonatal Borna disease virus infection-induced neurodevelopmental damage. II. Neu-
rochemical alterations and responses to pharmacological treatments. Brain Research 944:108–
123.
Sprankel H, Richard K, Ludwig H, Rott R. 1978. Behavior alterations in tree shrews (Tupaia glis,
Diard 1820) induced by Borna disease virus. Medical Microbiology and Immunology 26:1–18.
Weissenbock H, Hornig M, Hickey WF, Lipkin WI. 2000. Microglia activation and neuronal apoptosis
in bornavirus infected neonatal Lewis rats. Brain Pathology 10:260–272.

INFECTION, CANCER, AND THE IMMUNE RESPONSE

David H. Persing, M.D., Ph.D.
Corixa Corporation and the Infectious Disease Research Institute, Seattle, WA
and
Franklyn G. Prendergast, M.D., Ph.D.
Department of Pharmacology and the Mayo Clinic Cancer Center,
Rochester, MN

During the past decade, the scientific community has witnessed a virtual
explosion of information regarding the genetic basis of disease, especially of in-
herited disorders and human cancers. Much of the effort of the Human Genome
Initiative has been focused on genetic abnormalities that arise during the develop-
ment of neoplasia and upon congenital predispositions to cancer that are associ-
ated with the inheritance of mutations within tumor suppressor genes and other
loci. These studies are of critical importance to our understanding of genetic and
cellular processes contributing to neoplasia. However, to date the evidence sug-
gests that inherited predisposition to cancer probably accounts for only a subset
of total cancer patients and appears to be insufficient to explain the sporadic cases
currently comprising the majority.
In most models of the development of neoplasia, an underlying assumption
is the contribution of an array of intrinsic and extrinsic factors within a multi-step
process. A basic prerequisite of many models is an increase in the baseline prolif-
eration rates of essentially normal cell populations, accompanied by genotypic
and phenotypic alterations leading to dysregulation of normal growth control
mechanisms. Accordingly, preneoplastic conditions are often associated with an
increase in the proliferation of tissues, and some cancer predisposing conditions
result from inherited predispositions toward increased mitotic rate (e.g., familial
polyposis). However, virtually any condition leading to increased cellular prolif-
eration, whether by a direct or indirect mechanism, might potentiate the develop-
ment of malignancy. Since many infectious processes often lead, directly or indi-
rectly, to increased cell turnover and proliferation, certain agents are now widely
regarded as carcinogens (Rosenthal and Purtilo, 1997).

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

OBSTACLES AND OPPORTUNITIES FOR FRAMING FUTURE RESEARCH 155

In 1991, zur Hausen estimated that a significant fraction of all human can-
cers worldwide are associated with infections due to viruses, including human
papillomaviruses (cervical cancer and other skin cancers), human T-cell leuke-
mia viruses (adult T-cell leukemias and lymphomas in endemic areas), hepatitis
B virus (liver cancer), and Epstein-Barr virus (Burkitt’s lymphoma and nasopha-
ryngeal carcinoma) (zur Hausen, 1991). The estimate of the influence of infection
may now need to be revised in light of the fact that new viral associations have
been discovered and that other, nonviral associations have been uncovered
(Rosenthal and Purtilo, 1997). These include a common bacterial pathogen
(Helicobacter pylori infection with gastric carcinoma and MALT lymphoma),
and new viruses (hepatitis C virus with liver cancer, HHV-6 with non-Hodgkin’s
lymphoma, HHV-8 [a.k.a. KSHV]) with Kaposi’s sarcoma, Castleman’s disease,
and body cavity lymphomas (Mueller, 1995). In addition, new disease associa-
tions are being made with respect to previously known pathogens, such as the
association of chronic hepatitis C virus infection with non-Hodgkin’s lymphoma
in certain populations (Luppi et al., 1996). The following sections will summa-
rize briefly some of the established and emerging associations between chronic
infections and human cancer, as reflected in Table 3-1.

Chronic Bacterial Infections Associated with Human Malignancy

Helicobacter pylori
After many years of unwarranted skepticism, the medical establishment in
the United States and worldwide generally now recognizes Helicobacter pylori
as the most common cause of diffuse superficial gastritis and gastric and duode-
nal ulcers (McGowan et al., 1996). Infections caused by H. pylori persist within
the gastric mucosa for many years, and the incidence of infection is associated
with lower economic status and increasing age. Consistent with the step-wise
elucidation of the role of the etiologic agent, the treatment for gastric and duode-
nal ulcer has evolved from a surgical approach (gastrectomy), to medical man-
agement of gastric hyperacidity (H2 blockers), and most recently toward antibi-
otic therapy directed against H. pylori (McGowan et al., 1996).
Inflammation associated with H. pylori infection may progress to chronic
atrophic gastritis, which is a known predisposing condition for the development
of gastric carcinoma. Accordingly, H. pylori infection has been linked epidemio-
logically to gastric adenocarcinoma; many studies involving thousands of partici-
pants have now shown an increased risk of gastric cancer in persons with elevated
antibodies to Helicobacter pylori and in known H. pylori carriers (Uemura et al.,
2001). It is probable that host genetic factors (blood type, HLA type, other immu-
nogenetically determined factors) as well as microbial virulence factors (particu-
larly the presence of the cagA virulence factor) contribute to tissue burden of
organisms, persistence of infection, and the nature of the inflammatory response,

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

156 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

TABLE 3-1 Infectious Agents Associated with Malignancies

Infectious Agent Neoplasm
BACTERIA

Helicobacter pylori Gastric adenocarcinoma, intestinal type

MALT lymphoma, non-Hodgkin’s lymphoma

Fusobacterium fusiforme and Squamous cell carcinoma arising from tropical

Borrelia vincentii phagedenic ulcer

Vibrio cholerae Possible associations with immunoproliferative small

intestinal disease (IPSID), non-Hodgkin’s lymphoma

VIRUSES

Epstein-Barr virus Burkitt’s lymphoma, nasopharyngeal carcinoma, and

reversible lymphoproliferative diseases in
immunodeficient patients

Human T-lymphotropic viruses Adult T-cell leukemia, T-cell lymphoma

I and II

Human papillomavirus Cutaneous and mucosal papillomas and carcinomas

Hepatitis B and C viruses Hepatitis, chronic active hepatitis and hepatocellular

carcinoma

Human herpesvirus-8 (KSHV) Kaposi’s sarcoma, body cavity lymphoma

Human immunodeficiency virus Kaposi’s sarcoma, and non-Hodgkin’s lymphoma,

cutaneous and mucosal papillomas and carcinomas

SV-40 Possible associations with mesothelioma and

ependymoma
PROTOZOA

Strongyloides stercoralis T-cell leukemia (with HTLV)

Plasmodium falciparuma Burkitt’s lymphoma

Schistosoma hematobium Squamous cell carcinoma of the urinary bladder

S. mansoni, S. japonicum Colonic carcinomas

Clonorchis sinensis Cholangiocarcinoma

Opisthorchis viverrini Cholangiocarcinoma

aPlasmodium falciparum is a cofactor for development of Burkitt’s lymphoma in endemic regions.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

OBSTACLES AND OPPORTUNITIES FOR FRAMING FUTURE RESEARCH 157

all of which may contribute directly or indirectly to the development of carci-

noma (Delchier et al., 2001). The association of H. pylori infection with gastric
cancer was an important landmark, because it provided the first definitive link
between a chronic bacterial infection, chronic inflammation originating within
the target tissue, and the ultimate development of a human cancer.
Perhaps even more provocative has been the association of H. pylori with
lymphoproliferative disease. H. pylori infection is associated with a proliferative
response of mucosa-associated lymphoid tissues (MALT). This polyclonal or
oligoclonal lymphocytic proliferation, which consists mostly of B cells, appears
to be predisposed toward the subsequent development of malignant lymphomas
of the non-Hodgkin’s type (Delchier et al., 2001). Several studies have now dem-
onstrated regression of early MALT lymphomas by antibiotic treatment directed
against H. pylori (Fischbach et al., 1997; Weber et al., 1994). This suggests fur-
ther that the maintenance of the MALT lesion is directly associated with H. pylori
infection, and may in fact be due to an antigen (or perhaps superantigen) and/or
cytokine-driven proliferative response. Non-Hodgkin’s lymphomas harboring
bcl2 rearrangements may emerge years after regression of the underlying MALT
lymphoma by antibiotic therapy directed against H. pylori (Horstmann et al.,
1994); it has been proposed that malignant cells may already be present in small
numbers within the late-stage MALT lymphoma population prior to antibiotic
treatment and may emerge thereafter as an antigen-independent lymphoprolif-
erative disease (Graham et al., 1994; Thijs et al., 1995).
An important implication of these findings is the potential for cancer chemo-
prevention directed against the underlying infectious agent. Treatment of H. py-
lori in early stages of infection could result in lower risk of developing complica-
tions of chronic infection (Thijs et al., 1995). However, because H. pylori
infections are common, and the development of cancer is an uncommon compli-
cation of infection, further work should be done to identify at-risk populations in
order to better target chemoprevention efforts (Graham et al., 1994).

Other Bacterial Infections

If H. pylori can serve as an infectious trigger of a lymphoproliferative dis-
ease, might other chronic bacterial infections also be involved? Small intestinal
lymphomas have been described as a complication of chronic infection with
Tropheryma whippeli, the Whipple’s disease-associated bacillus, which has been
documented to persist for many years (Gillen et al., 1993). Unrecognized cases of
Whipple’s disease may be more common than previously suspected, based on
findings of several recent studies employing detection methods based on the poly-
merase chain reaction (PCR) (Ramzan et al., 1997). A disease known as immuno-
proliferative small intestinal disease (IPSID) has been associated epidemiologi-
cally with enteric infection possibly due to Vibrio cholerae, primarily in
developing countries (Isaacson, 1994). Hyperplastic lymphoid tissue develops in

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

158 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

the small bowel in association with the disease, converting to malignant lym-
phoma at later stages. Consistent with the experience of regression of MALT
lymphoma in H. pylori-infected patients, tetracycline treatment sometimes causes
regression of IPSID lesions in patients with early lesions, and is often used in
conjunction with chemotherapy in later stage lesions (Trotman et al., 1999). Fi-
nally, tropical phagedenic ulcer is a chronic persistent dermatological infection of
developing countries caused by coinfection with Fusobacterium and a spirochete,
Borrelia vincentii (Robinson et al., 1988). This infection leads to the develop-
ment squamous cell carcinoma within the depigmented margins of the ulcerative
lesion. Antibiotic treatment is effective for eliminating the bacterial infection and
presumably also for reducing cancer risk.
Taken together, it seems that chronic bacterial infections other than H. pylori
may also predispose to the development of malignancy, especially non-Hodgkins
lymphoma, by virtue of direct or indirect stimuli of target cell proliferation. Given
the increasing incidence of non-Hodgkin’s lymphoma in the US, and the fact that
the inciting organisms might be detectable in cancer patients at the time of pre-
sentation suggests that pathogen discovery efforts aimed at well-defined patient
populations might well be productive. More importantly, effective chemopre-
vention strategies may depend upon the identification of microbial, environmen-
tal, and host determinants in the development of neoplasia.

Parasitic Infections Associated with Malignancy

Some infections with protozoa are associated with malignancy in humans.
Burkitt’s lymphoma is thought to arise from the convergence of two pathogens in
the same host—Epstein-Barr virus and the malarial parasite, Plasmodium
falciparum. Clustered cases of Burkitt’s lymphoma match the geographic distri-
bution of holoendemic malaria (Facer and Playfair, 1989). The well-known im-
munosuppressive effects of chronic malarial infection are thought to predispose
the host to the transforming effects of EBV, perhaps by a mechanism similar to
that described for EBV-related malignancies in immunosuppressed hosts (Lam et
al., 1991). Another possible virus/parasite interaction in the development of ma-
lignancy is the possible association of Strongyloides stercoralis in the develop-
ment of HTLV-associated leukemia which is mentioned below (Plumelle et al.,
1997).
Schistosomiasis, a helminth infection with a wide geographic distribution, is
associated with carcinoma of the urinary bladder (Rosin et al., 1994). Chronic
infection with S. hematobium causes chronic inflammation, fibrosis, and increased
proliferation of squamous cells; malignant squamous cell carcinomas usually arise
from this premalignant proliferative lesion. In contrast, most malignant tumors of
the bladder that arise outside of the context of infection with S. hematobium in
endemic areas are transitional cell carcinomas. A similar mechanism of increas-
ing cell turnover may apply to the development of cholangiocarcinoma during

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

OBSTACLES AND OPPORTUNITIES FOR FRAMING FUTURE RESEARCH 159

chronic biliary tract infection with Clonorchis sinensis and Opisthorchis viverrini
(Shin et al., 1996). Infection with both of these organisms is associated with
chronic inflammation and proliferation of the biliary epithelium. Chronic inflam-
mation of the bile duct epithelium due to infection with the newly recognized
protozoa Septata intestinalis and Cryptosporidium parvum have been recognized
in this country, but it is not yet known whether these infections are associated
with malignancy.

Viruses Associated with Human Malignancies

Although malignancies associated with viral infection have been studied in
animal models for decades, clear evidence of involvement of viral infection in
human malignancies has been lacking until about the past decade. A growing
number of viral infections have been associated with various human malignan-
cies including carcinomas and adenomas of the cervix and upper airways, liver
cancer, and lymphomas and leukemias. As mentioned above, it is estimated that
approximately 15 percent of all malignancies worldwide are associated with
known viral infections. This estimate is based on associations with already known
viral infections. However, recent history has documented that there are likely to
be many viral infections of humans that are still to be uncovered.
Malignancy associated with viral infection has in some cases been attributed
to direct effects of viral gene products, as described above for the human
papillomavirus, or it may be associated with increased cellular proliferation of a
target tissue, as described for the bacterial infections above. In both settings, host
immune responses are likely to play an important role in the tolerance of persis-
tent viral infection.

The Gamma-herpesviruses, EBV and KSHV

Since its discovery in the early 1960s in an African Burkitt’s lymphoma cell
line, Epstein-Barr virus has become widely regarded as an oncogenic virus, espe-
cially in the immunocompromised host. It is also highly prevalent in the US and
worldwide, with 80–90 percent seroconversion by young adulthood in most coun-
tries. Most childhood infections are clinically silent, but primary EBV infection
in older children or young adulthood is the major cause of acute mononucleosis.
During primary infection a polyclonal expansion of B cells occurs resulting in the
formation of heterophile antibodies as well as EBV-specific cellular and humoral
immune responses. Latency is established in a subset of B cells which can be
interrupted under certain conditions to produce reactivation of infection
(Goldschmidts et al., 1992).
In the mid-1950s, missionary doctor Denis Burkitt described a unique malig-
nant lymphoma of childhood usually involving the jaw and viscera. He later iden-
tified the distribution of cases of the lymphoma to areas of Africa that are en-

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

160 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

demic for malaria (the “lymphoma belt”). To this day, Burkitt’s lymphoma re-
mains one of the most dreaded diseases in sub-Saharan Africa. EBV can be found
in nearly 100 percent of endemic lymphomas, in contrast to its lower prevalence
in non-endemic Burkitt-type malignancies. In both endemic and non-endemic
tumor types, translocation of the c-myc cellular oncogene to an expressed locus
downstream from the immunoglobulin G promoter (IgG-P) occurs by gene rear-
rangement. However, the IgG-P/c-myc breakpoints in endemic cases occur within
a more tightly clustered region, suggesting stereotypic recombinational patterns
in the malaria-associated cases. Whether this pattern of recombination occurs
directly in response to malarial infection is currently unknown (Facer and Playfair,
1989), but an attractive hypothesis is that immunoglobulin gene rearrangement
driven by expansion of Plasmodium-specific B-cells participates in the develop-
ment of malignant clones. Differences in EBV subtypes have been observed in
endemic and non-endemic cases; endemic cases contain EBV subtype 2, in con-
trast to non-endemic cases which usually harbor EBV subtype 1 (Magrath et al.,
1992). Mechanisms for the possible pathogen interaction between EBV and Plas-
modium are poorly understood; the well known immunosuppressive effects of
malarial infection have been proposed by several investigators to activate EBV-
associated lymphoproliferation (Lam et al., 1991). The combination of immuno-
suppression with antigen-specific proliferation may, in this model, lead to the
development of a unique type of cancer.
EBV is also associated with nasopharyngeal carcinoma (NPC), a malignancy
that represents the most common tumor of males in southern China. Additional
environmental exposures to salted fish containing nitrosodimethylamines, and
perhaps inhaled herbal extracts have been implicated as possible cofactors in the
development of this malignancy. Latent forms of the EBV genome can be de-
tected by in situ hybridization. Immunologic predisposition may also contribute,
as reflected in relative overrepresentation of certain HLA types in patients with
NPC along with evidence of intrafamilial case clustering. In addition, an atypical
immune response as determined by the presence of IgA to certain EBV proteins
suggests that an aberrant immune response to the virus may underlie cancer risk
(Hsu et al., 2001). This EBV-specific IgA response may be an indirect, albeit
diagnostically important, indication of EBV infection on mucosal surfaces which
itself serves as a proferative stimulus of epithelial cell populations accompanied
by lymphocytic infiltration (lymphoepithelioma).
A recent report implicated EBV in the development of human breast cancer
(Magrath and Bhatia, 1999); various studies have detected up to a 51 percent
prevalence of EBV in breast cancer tissues, depending on the methods used. Since
the known EBV-associated carcinomas are lymphoepitheliomas, and since most
breast carcinomas are not lymphoepitheliomas, these findings have been contro-
versial and indeed many studies fail to confirm the initial findings (Chu et al.,
2001). A critical link to be established here would be the demonstration of un-
usual immunological responses to EBV proteins as demonstrated for NPC.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

OBSTACLES AND OPPORTUNITIES FOR FRAMING FUTURE RESEARCH 161

In the developed world, the most common EBV-associated tumor is non-

Hodgkin’s lymphoma associated with immunosuppression. Most non-Hodgkin’s
lymphomas originating in the context of HIV infection are associated with EBV,
and CNS lymphomas in AIDS patients are nearly exclusively EBV positive
(Knowles, 1996). In transplant recipients, EBV-associated tumors often originate
as polyclonal or oligoclonal proliferations, occasionally evolving into monoclonal
populations (Ambinder, 1990). Reversal of immunosuppression often leads to
regression of polyclonal lymphoproliferative disease, consistent with the control
of direct proliferative effects of EBV by cytotoxic T-cell responses. Once the
tumor has become predominantly monoclonal, however, reversal of immune sup-
pression often has no effect. The progression of non-Hodgkin’s lymphomas in
immunosuppressed patients is reminiscent of the development of MALT lym-
phoma, in which an initial polyclonal lymphoproliferative response is followed
by the evolution of more aggressive tumors that are apparently less subject to
immune surveillance.
A new member of the gamma-herpesvirus family was recently discovered by
the application of nucleic acid-based pathogen discovery techniques to Kaposi’s
sarcoma (KS). KS had long been suspected to have an infectious etiology because
of its peculiar epidemiology (Chang and Moore, 1996). The newly recognized
virus, which has been called human herpesvirus 8 or KS-associated herpesvirus
(KSHV), has been found in HIV-associated cases as well as in non-HIV associ-
ated endemic KS in Mediterranean and African men (Moore and Chang, 1995). A
similar virus of primates, Herpesvirus samirai, causes an aggressive T-cell lym-
phoma and polyclonal B-cell proliferation in an experimental model of primate
infection (Trimble and Desrosiers, 1991). Current epidemiologic evidence sug-
gests that KSHV is necessary but not sufficient for development of most cases of
KS. Defects in immune surveillance may contribute to the evolution of KSHV-
associated lesions in a manner similar to its more highly prevalent cousin, EBV;
these defects may be acquired or intrinsic in nature.
Recently, KSHV was recognized in dendritic cells of the bone marrow from
patients with multiple myeloma and a smaller number of patients with mono-
clonal gammopathy of unknown significance (MGUS), a paraproteinemia which
often predisposes to myeloma (Beksac et al., 2001; Rettig et al., 1997). Multiple
myeloma is a malignancy of B-cells which represents the second most frequently
diagnosed hematologic malignancy in the US. These findings were and still are
controversial, especially from an epidemiologic perspective, and subsequent stud-
ies have failed to detect an association with KSHV infection in myeloma patients
(Ablashi et al., 2000).

Human Retroviruses
The human retroviruses, human T cell leukemia viruses type I and II, infect
millions of persons worldwide and are associated with various neoplastic mani-

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

162 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

festations and immunologic abnormalities. HTLV infects approximately one mil-

lion people in the Japanese islands and localized populations within the Carib-
bean basin and South America. HTLV-related lymphomas are common in these
areas, and approximately 400 patients develop HTLV associated leukemia yearly
in Japan. The fact that only a small subset of HTLV infected patients develop
malignant manifestations clearly implicates other factors, either environmental or
genetic, that may predispose patients to neoplasia within the multi-step pathway.
In the tropics, the high frequency of HTLV-associated malignancies in areas en-
demic for other protozoal diseases has suggested that coinfection with the latter
may play a role in their pathogenesis. Recently, infection with Strongyloides
stercoralis was found to be an independent risk factor for development of HTLV-
associated leukemia in Jamaica (Plumelle et al., 1997). The increasingly recog-
nized immunosuppressive effects of HTLV infection on the cytotoxic T cell re-
sponse may also be implicated in the development of other cancers, such as
carcinoma of the cervix (Strickler et al., 1995).
Perhaps because it is only rarely associated with lymphomagenesis in the
United States, relatively less attention has been paid to this virus compared to its
distant cousin, HIV. However, many valuable lessons have been learned about
the transforming ability of human retroviruses in the development of HTLV-
related neoplasia. Furthermore, with the advent of powerful new pathogen dis-
covery techniques, it is possible that additional human retroviruses will be found
and that experience gained from evaluation of HTLV-associated cases could be
extrapolated to other diseases. Indeed, given the wide variety of exogenous and
endogenous retroviruses found within other higher primate species, this seems
likely. Several novel endogenous retroviruses have been isolated and identified in
patients with autoimmune diseases and malignancies. In the case of human semi-
noma, elevated antibody titers to retroviral gag proteins from a novel human
endogenous retrovirus (strain K10) that was originally isolated from a seminoma
tumor cell line are found in patients and very infrequently in healthy controls
(Sauter et al., 1995). Antigens crossreactive with Jaagsiekte virus, a known caus-
ative agent in the development of lung adenocarcinoma of sheep, have been
detected in human lung carcinoma specimens (Palmarini et al., 1999). Sequences
related to known oncogenic retroviruses have also been detected in human breast
cancers (Liu et al., 2001). Phylogenetic analyses of other (presumably) exogenous
and known endogenous retroviruses have shown that some are related to verte-
brate oncoviruses found in mice (mouse mammary tumor virus) as well as to
primate endogenous retroviruses. Further work will be necessary to determine
whether the sequences of these exogenous and endogenous viruses play a signifi-
cant role in human cancers or other malignancies.
Malignancies associated with HIV infection include increased susceptibility
to cervical dysplasia, squamous cell carcinoma, B cell lymphomas, Kaposi’s sar-
coma, and possibly seminomas and testicular cancer. It is interesting that in most
examples of increased frequency of malignancy in HIV patients, viral cofactors

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

OBSTACLES AND OPPORTUNITIES FOR FRAMING FUTURE RESEARCH 163

have been directly implicated in the progression of neoplasia. Epstein-Barr virus

plays an important role in the evolution of B cell lymphomas in these patients,
Kaposi’s sarcoma virus participates in the tumorigenesis of Kaposi’s sarcoma,
and human papillomavirus infection contributes to the development of carcino-
mas of the skin and cervix. A reduction in levels of antigen-specific cytotoxic T
cell responses are associated with activation of infection or disease progression in
all of these cases, and a reduction in the efficiency of immune surveillance has
been proposed as a factor in tumorigenesis. Consistent with this hypothesis, pa-
tients on immunosuppressive therapy following transplantation appear to be at
increased risk for the same spectrum of malignancies with the exception of a
lower incidence of KS; accordingly, KSHV appears to be much less prevalent in
transplant patients compared to HIV patients, presumably because of the risk
factors associated with the predominantly sexual transmission of KSHV (Chang
and Moore, 1996) .

Hepatitis B Virus
Primary infection with hepatitis B virus usually follows an acute and conva-
lescent course in immunocompetent hosts with ultimate resolution of disease.
However, in approximately 5 to 10 percent of adults, and in most infants born to
infected carrier mothers, primary infection leads to chronic active hepatitis which
may progress to cirrhosis of the liver and hepatocellular carcinoma (Kew, 1996).
Continuous proliferation of hepatocytes, which may be present for the life of the
host, is a prominent feature of chronic active hepatitis; in such patients, the rela-
tive risk of developing hepatocelluar carcinoma is increased 20–40 fold. Because
of the large number of carriers of hepatitis B virus (HBV), approximately 200
million persons worldwide, hepatocellular carcinoma is one of the most common
cancers in the world and is the most common cancer in HBV-endemic areas of
the Far East and sub-Saharan Africa. The development of hepatocellular carci-
noma probably depends upon direct effects of certain viral determinants along
with chronic persistent proliferation of hepatocytes. HBV-related hepatocellular
carcinomas often contain defective HBV genomes expressing one or more viral
open reading frames; the viral X gene, which is often expressed in malignant
tissues, is a transcriptional transactivator of host promoter sequences including
those associated with oncogene expression and integrated viral genomes can acti-
vate host proto-oncogenes. There is little doubt that continuous proliferation of
hepatocytes is also an important contributor to the development of neoplastic
disease, since other disorders associated with chronic hepatitis and hepatocyte
turnover (such as chronic alcoholism or hereditary hemochromatosis) may also
lead to an increased predisposition to liver cancer, and the effects of alcohol in-
gestion and viral infection may well be synergistic in this regard (Brechot et al.,
1996).

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

164 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

Hepatitis C Virus
A rapidly emerging association of chronic viral infection with malignancy is
the development of hepatocellular carcinoma associated with chronic hepatitis C
virus infection. In the United States, HCV infection is projected to become the
major cause of liver cancer, due in part the large number of chronic carriers in this
country, currently estimated at 3.5 million persons. In the case of HCV infection,
a major determinant of development of hepatocellular cancer appears to be dura-
tion of infection and the degree of persistent liver injury (Zein and Persing, 1996).
Several studies have associated certain HCV subtypes with differences in liver
disease severity, interferon responsiveness, and duration of infection. Viral sub-
types that appear to have been in the U.S. population for longer periods of time
are dramatically overrepresented among patients with liver cancer. Specifically,
subtype 1b, which is present in 15–20 percent of cases nationwide, is present in
90 percent or more of liver cancer patients in several studies conducted at differ-
ent centers (Zein et al., 1996). Since presence of genotype 1b appears to be a
marker of longer duration of infection in U.S. patients, it is possible that other
genotypes will be more commonly implicated in cases of hepatocellular carci-
noma in other countries, and that the overrepresentation of genotype 1b in the
United States will decline over time. Additional factors such as alcohol consump-
tion may contribute independently to risk of neoplasia, even in patients with more
recent infections (Brechot et al., 1996). As for HPV infection, host immunoge-
netic or other factors may play a role in susceptibility to viral infection as well as
in determining the severity of infection (see below).
Recently, chronic HCV infection has been associated with the development
of B-cell non-Hodgkin’s lymphomas in an Italian population (Mele et al., 2003)
and with the development of cryoglobulinemia and monoclonal gammopathy in
the United States (Cacoub et al., 1994). The development monoclonal
gammopathy is thought to presage the development of hematologic malignancies
in a significant subset of cases; it is not yet known whether HCV-associated mono-
clonal gammopathy or mixed cryoglobulinemia is a predisposing variable for the
development of such malignancies in the United States. One recent study sug-
gests that HCV infection-associated lymphoproliferative disease might include
multiple myeloma (Montella et al. 2001). It is possible that MGUS is a marker of
an underlying benign, perhaps antigen driven lymphoproliferative process, which
may after many years convert to a malignant process via somatic mutation. In this
respect, the genesis of neoplasia may be similar to that described for Helicobacter
pylori-related MALT lymphoma. The relative disparity in the frequency of non-
Hodgkin’s lymphoma associated with HCV infection in the United States com-
pared to that in Europe may conceivably reflect differences in duration of infec-
tion within the population, immunogenetic differences, or exposure to other
oncoviruses including KHSV.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

OBSTACLES AND OPPORTUNITIES FOR FRAMING FUTURE RESEARCH 165

Human Papillomavirus Infection

In the past decade, human papillomavirus (HPV) has emerged as the single
most important risk factor for development of cervical carcinoma, and it may be
associated with neoplasia in other tissues as well. To date, more than 80 HPV
subtypes have been described in a wide variety of epithelial tissues, with some
viral subtypes found exclusively in certain tissues; partial sequences of novel
subtypes indicate that over 100 subtypes may exist in humans. It is estimated that
approximately 95 percent of cervical cancers worldwide are associated with in-
fection by certain human papillomavirus subtypes, usually types 16 or 18 but
occasionally other types. HPV-associated cervical cancers typically harbor at least
remnants of the HPV genome in the form of two viral oncogenes which are con-
sistently expressed in malignant tissues. The viral E6 gene product binds to tumor
suppressor protein p53, promoting its degradation, and the viral E7 product binds
to the retinoblastoma gene product, resulting in a functional inactivation. In addi-
tion, the E6 and E7 oncoproteins stimulate cell proliferation by activating cyclins
E and A. The combination of these effects is to immortalize keratinocytes in
vitro. However, additional mutational events are apparently needed to provide
the fully transformed phenotype, since immortalized keratinocytes do not form
tumors in vivo (zur Hausen and Rosl, 1994). Nonetheless, the viral E6 and E7
genes and their products may become attractive diagnostic targets for monitoring
metastatic disease and for the development of tumor-specific immunotherapeutic
protocols.
The association of HPV infection with carcinomas of other tissues has been
less clear cut, but is somewhat reminiscent of the early days of research on the
association of HPV with cervical cancer in which a fundamental limitation in the
detection of the large variety of HPV types led initially to great controversy. On
the other hand, the inherent proneness of PCR technology to contamination prob-
lems, coupled with its ability to detect extremely small numbers of possibly inci-
dental HPV contaminants, warrants a careful interpretation of the growing num-
ber of reports implicating this virus in malignancies of many types. Archetypal
“oncogenic” subtypes of HPV appear capable of infecting different anatomical
sites, and associations of HPV infection with squamous cell carcinomas of the
head and neck are reasonably well established. The involvement of HPV in the
pathogenesis of skin cancer, the most common malignancy in the world, was
suggested recently and a new family of HPV types has now been described in
recurrent squamous cell carcinomas of the skin in transplant patients (Shamanin
et al., 1996). This finding seems consistent with the clinical experience in pa-
tients who are immunosuppressed by HIV infection, in which cervical dysplasia
is highly prevalent (Sun et al., 1995).
The role of HPV infection in epithelial carcinomas of the bladder and lung
are also being investigated. Studies of the bovine papilloma virus (BPV) have
been shown to have an association with cancer of the bladder in cattle (Olson et

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

166 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

al., 1965). Inoculation of BPV into newborn hamsters or mice has also been dem-
onstrated to induce tumors (zur Hausen, 1996). Some human studies in recent
years have suggested that relatively common HPV types can be detected in hu-
man transitional cell carcinoma (TCC) of the bladder in up to 34 percent of cases
in certain patient populations (Smetana et al., 1995), but the presence of HPV in
the neoplastic tissue has been difficult to demonstrate with consistency (Chetsanga
et al., 1992). Interestingly, cases of rapidly progressive multifocal TCC of the
bladder have been reported in patients following renal and cardiac transplanta-
tion, suggesting that HPV may play a more significant role in TCC of the bladder
in immunosuppressed patients (Noel et al., 1994). Although smoking history is
the leading risk factor in the development of squamous cell carcinoma of the
lung, a recent study implicated the presence of HPV type 16 in an unexpectedly
high number of cases of well-differentiated squamous cell carcinoma of the lung
on the island of Okinawa (Kinoshita et al., 1995). However, although some stud-
ies have supported this finding (Hirayasu et al., 1996), others have failed to impli-
cate HPV in lung cancer (Szabo et al., 1994). In this regard, it is interesting to
note that risk of cervical cancer is linked epidemiologically to risk of carcinoma
of the lung but not uterine or ovarian cancers, and that both of the former are
linked to smoking (Anderson et al., 1997). Clearly, additional studies will be
necessary which are designed to rule out the effects of incidental virus and DNA
contamination, yet also designed to be capable of detection of the widest range of
HPV types.
Recent studies of the natural history of HPV infection have suggested that
the ability of the genetically heterogeneous papillomaviruses to exploit relative
deficiencies in the immune response may represent an important determinant of
the risk of developing chronic infection and subsequent neoplastic disease. Atten-
tion has focused recently on cytokine production in HPV-specific helper T lym-
phocyte populations in women with cervical cancer compared to women in whom
the disease regresses spontaneously. Several studies have now indicated that fail-
ure to mount cytotoxic T cell (CTL) responses to human papillomavirus-infected
cells may significantly predispose to the development of cervical cancer (Tsukui
et al., 1996); this failure may be virus type-specific, such that the types repre-
sented most often in cervical cancer are those most successful at avoidance of
CTL activity (Ellis et al., 1995). Conditions associated with reduced CTL activ-
ity, such as HIV and HTLV infection, oral contraceptive use, pregnancy, and
immune suppression associated with transplantation have likewise been associ-
ated with increased HPV viral burden and acceleration of disease progression
(Sun et al., 1995). Twin studies have suggested that risk factors for cervical can-
cer, as for another HPV-associated lesion, epidermoplasia verruciformis, may be
inherited (Ahlbom et al., 1997). More recent studies have failed to detect an asso-
ciation with somatic mutations in the gene encoding p53, and have further ex-
plored associations with the immunoglobulin gene cluster (Cuzick et al., 2000).
Understanding the contribution of the environmental, host somatic, and host im-

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

OBSTACLES AND OPPORTUNITIES FOR FRAMING FUTURE RESEARCH 167

munogenetic factors to the development of HPV-related dysplasia is an area of

intense research activity which may lead to direct practical benefits to patients in
the form of improved immunomodulatory approaches to early and late stage le-
sions. Since the prevalence of HPV infection is so high, the use of routine testing
for HPV is of questionable value (Stoler, 2001), except in patients with Pap smears
containing atypical features (ASCUS). Clearly, if additional immunogenetic and
other host susceptibility factors can be identified, the positive predictive power of
HPV testing in cervical cancer screening programs may increase to acceptable
levels (Klug et al., 2001).

The Role of Humoral and Cellular Immune Responses

As illustrated vividly by HIV infection, infection with one pathogen may
lead to a predisposition toward other infectious processes as well as cancer; a key
feature of the immune suppression associated with HIV infection and pharmaco-
logically-produced immunosuppression following transplantation is a reduction
of cytotoxic T-cell (CTL) and related T-helper type 1 responses (Spina and Tirelli,
1992). One important theme that recurs among the above mentioned programs,
and in cancer research in general, is the relationship of T cell responses to the
evolving tumor. A decline in cytotoxic immunity has been associated with virus-
associated tumors in immunosuppressed patients, and relative deficits in the
establishment of CTL responses during the initial stages of infection are associ-
ated with progression of infection in otherwise immunocompetent hosts. Relative
differences in the ability to mount cytotoxic T-cell responses have been noted
among mouse strains for several years, and recent evidence suggests that immu-
nogenetic determinants in humans may play similar roles. From a teleological
perspective, it is likely that viruses and other pathogens associated with chronic
infections in humans have evolved means of avoiding CTL responses in at least
some hosts in order to maximize reservoir capacity. An example is the recent
documentation of point mutations within a dominant HLA B7-associated CTL
epitope of the human papillomavirus E6 gene product; the presence of sequence
variation has implications for vaccine design and immunotherapy, and overall,
viral diversity must be taken into account in the design of therapeutic strategies.
Just as the suppression of cellular immune responses may relate to develop-
ment of cancer, the development of humoral immune responses may be extremely
useful for determining the history of exposure to the pathogen and for the sero-
logic surveillance necessary to establish the etiologic role of a given pathogen.
Serologic studies have been critical to the understanding of the role of H. pylori
as an etiologic cofactor in various malignancies; when no such assays are avail-
able for a novel infectious agent, surrogate serologic assays can be used as pro-
posed previously (Persing, 1997). Furthermore, since IgG antibody subclasses
are generated on the basis of T-cell help, measurement of IgG subclasses may
lead to an understanding of the role of T-cell responses (i.e., the proportional Th1

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

168 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

and Th2-type responses) in determining the resolution or persistence of a particu-

lar infection (Moro et al., 2001).

Role Reversal: The Cancer Cell as the Ultimate Eukaroytic Parasite

Independent of the etiologic roles of infectious agents in the development of
human cancer, in more than one sense, the cancer cell itself represents the ulti-
mate eukaryotic parasite. Cancer cells, like parasitic protozoa, use a variety of
mechanisms to avoid immune surveillance including persistence in small num-
bers, active secretion of immunosuppressive substances, downregulation of MHC
class 1-based recognition, and antigenic variation (Buchanan and Nieland-Fisher,
2001). Humoral immune responses to cancer-specific antigens often occur in can-
cer patients and are undetectable in patients without cancer (Disis et al., 1997),
suggesting that immunologic tolerance can be broken and that many types of
cancer-specific immune responses, in the form of tissue-specific autoimmune
phenomena, can be tolerated in humans. Antibody responses in cancer patients
have led to the discovery of many important cancer-specific antigens (Chen,
2000). At the same time, these studies point to the relative lack of efficacy of
humoral immune responses in the control of a developing malignancy, much the
same way that in chronic carriers of protozoan parasites, immune responses to
pathogen-specific antigens happily coexist with the pathogens themselves. In-
deed, many of the lessons learned from parasite immunology can be extrapolated
to human cancer, especially in the development of new vaccine-based approaches
to the treatment of both diseases.

Conclusions
In purely reductionistic terms, infectious diseases can be viewed as horizon-
tally acquired genetic disorders, in which exogenously acquired nucleic acids of a
pathogen integrate, either chromosomally, episomally, or extracellularly, with
those of the host to disrupt normal cellular processes or produce inflammation.
Developing a better understanding of the interactions of human microbial flora
with their hosts, along with an understanding of other host and environmental
determinants of pathogenicity, represents an increasingly important intersection
of infectious disease research with the Human Genome Project. Illustrations of
the latter concept are provided by the discovery of resistance to HIV infection by
virtue of mutations within a gene encoding an HIV coreceptor (CCR-5) (Samson
et al., 1996). Another important example is the inherited susceptibility to Myco-
bacterium avium-intracellulare infections in families carrying a mutant allele of
the interferon-gamma (IFN-γ) receptor (Newport et al., 1996). The identification
of such an allele within the human population has far-reaching implications, since
it may be associated with a general reduction in the ability to mount cytotoxic T-
cell responses during infections of many types. Genetic predisposition to

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

OBSTACLES AND OPPORTUNITIES FOR FRAMING FUTURE RESEARCH 169

papillomavirus infection appears to underlie the inherited skin disorder

epideromodysplasia verruciformis (Majewski and Jablonska, 1995), in which cy-
totoxic T-cell responses apparently fail to develop against certain papillomavirus
subtypes. Since early generation of such responses appears to be a critical step in
the resolution of human papillomavirus infections, patients harboring function-
ally similar mutations may be uniquely predisposed to the development of cervi-
cal and other cancers linked to HPV infection. By focusing on unusually severe
outcomes of relatively common infectious diseases, we may be able to identify
critical immunogenetic factors in the formation of protective immune responses,
and to tailor patient management and cancer chemoprevention efforts (in some
cases directed against the pathogens themselves) in appropriate ways.

REFERENCES
Ablashi DV, Chatlynne L, Thomas D, Bourboulia D, Rettig MB, Vescio RA, Viza D, Gill P, Kyle
RA, Berenson JR, Whitman JE. 2000. Lack of serologic association of human herpesvirus-8
(KSHV) in patients with monoclonal gammopathy of undetermined significance with and with-
out progression to multiple myeloma. Blood 96:2304–2306.
Ahlbom A, Lichtenstein P, Malmstrom H, Feychting M, Hemminki K, Pedersen NL. 1997. Cancer in
twins: genetic and nongenetic familial risk factors. Journal of the National Cancer Institute
89:287–293.
Ambinder RF. 1990. Human lymphotropic viruses associated with lymphoid malignancy: Epstein-
Barr and HTLV-1. Hematology Oncology Clinics of North America 4:821–833.
Anderson KE, Woo C, Olson JE, Sellers TA, Zheng W, Kushi LH, Folsom AR. 1997. Association of
family history of cervical, ovarian, and uterine cancer with histological categories of lung can-
cer—the Iowa women’s health study. Cancer Epidemiology, Biomarkers & Prevention 6:401–
405.
Beksac M, Ma M, Akyerli C, DerDanielian M, Zhang L, Liu J, Arat M, Konuk N, Koc H, Ozcelik T,
Vescio R, Berenson JR. 2001. Frequent demonstration of human herpesvirus 8 (HHV-8) in bone
marrow biopsy samples from Turkish patients with multiple myeloma (MM). Leukemia
15:1268–1273.
Brechot C, Nalpas B, Feitelson MA. 1996. Interactions between alcohol and hepatitis viruses in the
liver. Clinics in Laboratory Medicine 16:273–287.
Buchanan J and Nieland-Fisher NS. 2001. Role of immune function in human papillomavirus infec-
tion. Journal of the American Medical Association 286:1173–1174.
Cacoub P, Fabiani FL, Musset L, Perrin M, Frangeul L, Leger JM, Huraux JM, Piette JC, Godeau P.
1994. Mixed cryoglobulinemia and hepatitis C virus. American Journal of Medicine 96:124–
132.
Chang Y and Moore PS. 1996. Kaposi’s Sarcoma (KS)-associated herpesvirus and its role in KS.
Infectious Agents & Disease 5:215–222.
Chen YT. 2000. Cancer vaccine: identification of human tumor antigens by SEREX. Cancer Journal
6 (Suppl 3):S208–217.
Chetsanga C, Malmstrom PU, Gyllensten U, Morenolopez J, Dinter Z, Peterson U. 1992. Low inci-
dence of human papillomavirus type 16 DNA in bladder tumour detected by polymerase chain
reaction. Cancer 69:1208–1211.
Chu PG, Chang KL, Chen YY, Chen WG, Weiss LM. 2001. No significant association of Epstein-
Barr virus infection with invasive breast carcinoma. American Journal of Pathology 159:571–
578.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

170 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

Cuzick J, Terry G, Ho L, Monaghan J, Lopes A, Clarkson P, Duncan I. 2000. Association between

high-risk HPV types, HLA DRB1* and DQB1* alleles and cervical cancer in British women.
British Journal of Cancer 82:1348–1352.
Delchier JC, Lamarque D, Levy M, Tkoub EM, Copie-Bergman C, Deforges L, Chaumette MT,
Haioun C. 2001. Helicobacter pylori and gastric lymphoma: high seroprevalence of CagA in
diffuse large B-cell lymphoma but not in low-grade lymphoma of mucosa-associated lymphoid
tissue type. American Journal of Gastroenterology 96:2324–2328.
Disis ML, Pupa SM, Gralow JR, Dittadi R, Menard S, Cheever MA. 1997. High-titer HER-2/neu
protein-specific antibody can be detected in patients with early-stage breast cancer. Journal of
Clinical Oncology 15:3363–3367.
Ellis JR, Keating PJ, Baird J, Hounsell EF, Renouf DV, Rowe M, Hopkins D, Duggan-Keen MF,
Bartholomew JS, Young LS et al. 1995. The association of an HPV16 oncogene variant with
HLA-B7 has implications for vaccine design in cervical cancer. Nature Medicine 1:464–470.
Facer CA and Playfair JH. 1989. Malaria, Epstein-Barr virus, and the genesis of lymphomas. Ad-
vances in Cancer Research 53:33–72.
Fischbach W, Tacke W, Greiner A, Konrad H, Muller H. 1997. Regression of immunoproliferative
small intestinal disease after eradication of Helicobacter pylori. Lancet 349:31–32.
Gillen CD, Coddington R, Monteith PG, Taylor RH. 1993. Extraintestinal lymphoma in association
with Whipple’s disease. Gut 34:1627–1629.
Goldschmidts WL, Bhatia K, Johnson JF, Akar N, Gutierrez MI, Shibata D, Carolan M, Levine A,
Magrath IT. 1992. Epstein-Barr virus genotypes in AIDS-associated lymphomas are similar to
those in endemic Burkitt’s lymphomas. Leukemia 6:875–878.
Graham DY, Malaty HM, Go MF. 1994. Are there susceptible hosts to Helicobacter pylori infection?
Scandinavian Journal of Gastroenterology Supplement 205:6–10.
Hirayasu T, Iwamasa T, Kamada Y, Koyanagi Y, Usuda H, Genka K. 1996. Human papillomavirus
DNA in squamous cell carcinoma of the lung. Journal of Clinical Pathology 49:810–817.
Horstmann M, Erttmann R, Winkler K. 1994. Relapse of MALT lymphoma associated with
Helicobacter pylori after antibiotic treatment [letter] [see comments]. Lancet 343:1098–1099.
Hsu MM, Hsu WC, Sheen TS, Kao CL. 2001. Specific IgA antibodies to recombinant early and
nuclear antigens of Epstein-Barr virus in nasopharyngeal carcinoma. Clinical Otolaryngology
and Allied Sciences 26:334–338.
Isaacson PG. 1994. Gastrointestinal lymphoma. Human Pathology 25:1020–1029.
Kew MC. 1996. Hepatitis B and C viruses and hepatocellular carcinoma. Clinics in Laboratory Medi-
cine 16:395–406.
Kinoshita I, Dosaka-Akita H, Shindoh M, Fujino M, Akie K, Kato M, Fujinaga K, Kawakami Y.
1995. Human papillomavirus type 18 DNA and E6-E7 mRNA are detected in squamous cell
carcinoma and adenocarcinoma of the lung. British Journal of Cancer 71:344–349.
Klug SJ, Wilmotte R, Santos C, Almonte M, Herrero R, Guerrero I, Caceres E, Peixoto-Guimaraes D,
Lenoir G, Hainaut P, Walboomers JM, Munoz N. 2001. Tp53 polymorphism, hpv infection, and
risk of cervical cancer. Cancer Epidemiology Biomarkers and Prevention 10:1009–1012.
Knowles DM. 1996. Etiology and pathogenesis of AIDS-related non-Hodgkin’s lymphoma. Hema-
tology/Oncology Clinics of North America 10:1081–1109.
Lam KM, Syed N, Whittle H, Crawford DH. 1991. Circulating Epstein-Barr virus-carrying B cells in
acute malaria. Lancet 337:876–878.
Liu B, Wang Y, Melana SM, Pelisson I, Najfeld V, Holland JF, Pogo BG. 2001. Identification of a
proviral structure in human breast cancer. Cancer Research 61:1754–1759.
Luppi M, Grazia Ferrari M, Bonaccorsi G, Longo G, Narni F, Barozzi P, Marasca R, Mussini C,
Torelli G. 1996. Hepatitis C virus infection in subsets of neoplastic lymphoproliferations not
associated with cryoglobulinemia. Leukemia 10:351–355.
Magrath I and Bhatia K. 1999. Breast cancer: a new Epstein-Barr virus-associated disease? Journal of
the National Cancer Institute 91:1349–1350.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

OBSTACLES AND OPPORTUNITIES FOR FRAMING FUTURE RESEARCH 171

Magrath I, Jain V, Bhatia K. 1992. Epstein-Barr virus and Burkitt’s lymphoma. Seminars in Cancer
Biology 3:285–295.
Majewski S and Jablonska S. 1995. Epidermodysplasia verruciformis as a model of human
papillomavirus-induced genetic cancer of the skin. Archives of Dermatology 131:1312–1318.
McGowan CC, Cover TL, Blaser MJ. 1996. Helicobacter pylori and gastric acid: biological and thera-
peutic implications. Gastroenterology 110:926–938.
Mele A, Pulsoni A, Bianco E, Musto P, Szklo A, Sanpaolo MG, Iannitto E, De RenzoA, Martino B,
Liso V, Andrizzi C, Pusterla S, Dore F, Maresca M, Rapicetta M, Marcucci F, Mandelli F,
Franceschi S. 2003. Hepatitis C virus and B-cell non-Hodgkin lymphomas: an Italian multicenter
case-control study. Blood. 102(3):996–999.
Montella M, Crispo A, Frigeri F, Ronga D, Tridente V, De Marco M, Fabbrocini G, Spada O, Mettivier
V, Tamburini M. 2001. HCV and tumors correlated with immune system: a case-control study
in an area of hyperendemicity. Leukemia Research 25:775–781.
Moore PS and Chang Y. 1995. Detection of herpesvirus-like DNA sequences in Kaposi’s sarcoma in
patients with and without HIV infection [see comments]. New England Journal of Medicine
332:1181–1185.
Moro MH, Bjornsson J, Marietta EV, Hofmeister EK, Germer JJ, Bruinsma E, David CS, Persing DH.
2001. Gestational attenuation of Lyme arthritis is mediated by progesterone and IL-4. Journal of
Immunology 166:7404–7409.
Mueller N. 1995. Overview: viral agents and cancer. Environmental Health Perspectives 103(Suppl
8):259–261.
Newport MJ, Huxley CM, Huston S, Hawrylowicz CM, Oostra BA, Williamson R, Levin M. 1996. A
mutation in the interferon-gamma-receptor gene and susceptibility to mycobacterial infection.
New England Journal of Medicine 335:1941–1949.
Noel JC, Thiry L, Verhest A, Deschepper N, Peny MO, Sattar AA, Schulman CC, Haot J. 1994.
Transitional cell carcinoma of the bladder: evaluation of the role of human papillomaviruses.
Urology 44:671–675.
O’Connor F, Buckley M, O’Morain C. 1996. Helicobacter pylori: the cancer link. Journal of the
Royal Society of Medicine 89:674–678.
Olson C, Pamucku AM, Brobst DF. 1965. Papillomalike virus from bovine urinary tumours. Cancer
Research 25:840–847.
Palmarini M, Sharp JM, de las Heras M, Fan H. 1999. Jaagsiekte sheep retrovirus is necessary and
sufficient to induce a contagious lung cancer in sheep. Journal of Virology 73:6964–6972.
Persing DH. 1997. The cold zone: a curious convergence of tick-transmitted diseases. Clinical Infec-
tious Diseases 25(Suppl 1):S35–42.
Plumelle Y, Gonin C, Edouard A, Bucher BJ, Thomas L, Brebion A, Panelatti G. 1997. Effect of
Strongyloides stercoralis infection and eosinophilia on age at onset and prognosis of adult T-cell
leukemia. American Journal of Clinical Pathology 107:81–87.
Ramzan NN, Loftus E, Burgart LJ, Rooney M, Batts KP, Wiesner RH, Fredricks DN, Relman DA,
Persing DH. 1997. Diagnosis and monitoring of Whipple disease by polymerase chain reaction.
Annals of Internal Medicine 126(7).
Rettig MB, Ma HJ, Vescio RA, Pold M, Schiller G, Belson D, Savage A, Nishikubo C, Wu C, Fraser
J, Said JW, Berenson JR. 1997. Kaposi’s sarcoma-associated herpesvirus infection of bone
marrow dendritic cells from multiple myeloma patients. Science 276:1851–1854.
Robinson DC, Adriaans B, Hay RJ, Yesudian P. 1988. The clinical and epidemiologic features of
tropical ulcer (tropical phagedenic ulcer). International Journal of Dermatology 27:49–53.
Rosenthal LJ and Purtilo DT. 1997. Neoplasms associated with infectious agents. P. 1707. In Pathol-
ogy of Infectious Diseases, vol. II, DH Connor, FW Chandler, HJ Manz, DA Schwartz, EE
Lack, eds. Stamford, CT: Appleton and Lange.
Rosin MP, Anwar WA, Ward AJ. 1994. Inflammation, chromosomal instability, and cancer: the schis-
tosomiasis model. Cancer Research 54:1929s–1933s.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

172 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

Samson M, Libert F, Doranz BJ, Rucker J, Liesnard C, Farber CM, Saragosti S, Lapoumeroulie C,
Cognaux J, Forceille C, Muyldermans G, Verhofstede C, Burtonboy G, Georges M, Imai T,
Rana S, Yi Y, Smyth RJ, Collman RG, Doms RW, Vassart G, Parmentier M. 1996. Resistance
to HIV-1 infection in caucasian individuals bearing mutant alleles of the CCR-5 chemokine
receptor gene [see comments]. Nature 382:722–725.
Sauter M, Schommer S, Kremmer E, Remberger K, Dolken G, Lemm I, Buck M, Best B, Neumann-
Haefelin D, Mueller-Lantzsch N. 1995. Human endogenous retrovirus K10: expression of Gag
protein and detection of antibodies in patients with seminomas. Journal of Virology 69:414–
421.
Shamanin V, zur Hausen H, Lavergne D, Proby CM, Leigh IM, Neumann C, Hamm H, Goos M,
Haustein UF, Jung EG et al. 1996. Human papillomavirus infections in nonmelanoma skin
cancers from renal transplant recipients and nonimmunosuppressed patients [see comments].
Journal of the National Cancer Institute 88:802–811.
Shin HR, Lee CU, Park HJ, Seol SY, JM Chung, Choi HC, Ahn YO, Shigemastu T. 1996. Hepatitis
B and C virus, Clonorchis sinensis for the risk of liver cancer: a case-control study in Pusan,
Korea. International Journal of Epidemiology 25:933–940.
Smetana Z, Keller T, Leventon-Kriss S, Huszar M, Lindner A, Mitrani-Rosenbaum S, Mendelson E,
Smetana S. 1995. Presence of human papilloma virus in transitional cell carcinoma in Jewish
population in Israel. Cellular & Molecular Biology 41:1017–1023.
Spina M and Tirelli U. 1992. Human immunodeficiency virus as a risk factor in miscellaneous can-
cers. Current Opinion in Oncology 4:907–910.
Stoler MH. 2001. HPV for cervical cancer screening: is the era of the molecular Pap smear upon us?
Journal of Histochemistry and Cytochemistry 49:1197–1198.
Strickler HD, Rattray C, Escoffery C, Manns A, Schiffman MH, Brown C, Cranston B, Hanchard B,
Palefsky JM, Blattner WA. 1995. Human T-cell lymphotropic virus type I and severe neoplasia
of the cervix in Jamaica. International Journal of Cancer 61:23–26.
Sun XW, Ellerbrock TV, Lungu O, Chiasson MA, Bush TJ, Wright T Jr. 1995. Human papillomavirus
infection in human immunodeficiency virus-seropositive women. Obstetrics & Gynecology
85:680–686.
Szabo I, Sepp R, Nakamoto K, Maeda M, Sakamoto H, Uda H. 1994. Human papillomavirus not
found in squamous and large cell lung carcinomas by polymerase chain reaction [see com-
ments]. Cancer 73:2740–2744.
Thijs JC, Kuipers EJ, van Zwet AA, Pena AS, de Graaff J. 1995. Treatment of Helicobacter pylori
infections. QJM 88:369–389.
Trimble JJ and Desrosiers RC. 1991. Transformation by herpesvirus saimiri. Advances in Cancer
Research 56:335–355.
Trotman BW, Pavlick AC, Igwegbe IC, Goldstein MM. 1999. Immunoproliferative small intestinal
disease: case report and literature review. Journal of the Association for Academic Minority
Physicians 10:88–93.
Tsukui T, Hildesheim A, Schiffman MH, Lucci JR, Contois D, Lawler P, Rush BB, Lorincz AT,
Corrigan A, Burk RD, Qu W, Marshall MA, Mann D, Carrington M, Clerici M, Shearer GM,
Carbone DP, Scott DR, Houghten RA, Berzofsky JA. 1996. Interleukin 2 production in vitro by
peripheral lymphocytes in response to human papillomavirus-derived peptides: correlation with
cervical pathology. Cancer Research 56:3967–3974.
Uemura N, Okamoto S, Yamamoto S, Matsumura N, Yamaguchi S, Yamakido M, Taniyama K,
Sasaki N, Schlemper RJ. 2001. Helicobacter pylori infection and the development of gastric
cancer. New England Journal of Medicine 345:784–789.
Weber DM, Dimopoulos MA, Anandu DP, Pugh WC, Steinbach G. 1994. Regression of gastric lym-
phoma of mucosa-associated lymphoid tissue with antibiotic therapy for Helicobacter pylori.
Gastroenterology 107:1835–1838.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

OBSTACLES AND OPPORTUNITIES FOR FRAMING FUTURE RESEARCH 173

Zein NN and Persing DH. 1996. Hepatitis C genotypes: current trends and future implications. [Re-
view] [50 refs]. Mayo Clinic Proceedings 71:458–462.
Zein NN, Poterucha JJ, Gross J Jr, Wiesner RH, Therneau TM, Gossard AA, Wendt NK, Mitchell PS,
Germer JJ, Persing DH. 1996. Increased risk of hepatocellular carcinoma in patients infected
with hepatitis C genotype 1b. American Journal of Gastroenterology 91:2560–2562.
zur Hausen H. 1991. Viruses in human cancers. Science 254:1167–1173.
zur Hausen H. 1996. Roots and perspectives of contemporary papillomavirus research. Journal of
Cancer Research and Clinical Oncology 122:3–13.
zur Hausen H and Rosl F. 1994. Pathogenesis of cancer of the cervix. Cold Spring Harbor Symposia
on Quantitative Biology 59:623–628.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

Opportunities to Prevent and Mitigate the

Impact of Chronic Diseases Caused by
Infectious Agents

OVERVIEW
The ultimate goal in identifying connections between infectious agents and
chronic diseases is to find better ways to cure, or even prevent, those diseases.
Various therapeutic approaches may prove fruitful and deserve continued atten-
tion. Several of these areas were explored during the workshop, along with ways
to most effectively move therapeutic methods from the laboratory into widespread
practice. Discussion was somewhat limited, however, by time constraints and the
availability of speakers.
Among therapeutic possibilities, vaccines hold a special attraction, given their
unique record of totally eliminating or eradicating several target diseases. Recent
advances in molecular biology and genetics have provided powerful new meth-
ods for vaccine development. Of particular importance is the possibility offered
by the new sciences of genomics and proteomics to detect the relevant antigens
and to identify specific aspects of immunity that should be enhanced by the vac-
cine. There also have been important advances made in understanding the pro-
cesses of acquired immunity and the pathogenesis of various diseases (including
the interplay between microbe and host). Collectively, these efforts may point the
way to the eventual development of effective means to control at least some
chronic diseases.
To underpin scientific efforts, sound planning and program management is a
must. In order to most effectively develop and implement new prevention and
intervention efforts—encompassing vaccines and a host of other means—there
will need to be in place an overarching strategy to guide efforts across a range of
fronts. This strategy will rely heavily on collaborations to enhance the productiv-

174

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

OPPORTUNITIES FOR PREVENTION AND MITIGATION 175

ity of independent investigators, to integrate rigorously executed laboratory tech-

niques into well-designed epidemiologic studies and surveillance systems, and to
complement short-term studies with long-term follow-up. It also will be neces-
sary to develop funding mechanisms that recognize the value of such crosscutting
efforts.
Helena Mäkelä described the recent advances that are raising promise for the
development of vaccines to fight chronic diseases, either by preventing acute
infection or by curing established persistent infection. The possibility of develop-
ing a vaccine to fight cardiovascular disease, one of the major killers in the United
States and worldwide, served as an example. The vaccine would target Chlamy-
dia pneumoniae, which has been linked to atherosclerosis by several lines of
evidence, though its causative role has not been conclusively established. Among
efforts to date, researchers have developed an experimental model of C.
pneumoniae in the mouse, and work with this system is yielding fundamental
lessons. Also, a number of candidate vaccines have been prepared and tested for
prevention of acute infection, and several of them have proved to afford at least
partial protection.
Siobhán O’Conner presented a blueprint for the strategic approach that will
be needed to integrate laboratory research, epidemiology, and surveillance. This
blueprint is based on several basic tenets that stress the importance of standard-
ized or comparable case definitions—for the infection as well as the outcome—
and universally high standards of specificity, sensitivity, and reproducibility of
laboratory assays. As the field advances, a number of crosscutting issues also will
require continuous attention. One such issue will be the need to provide adequate
medical education (both academic training and continuing education) so that
health professionals will be able to capitalize on the benefits afforded by con-
firmed and newly discovered links between infectious agents and chronic dis-
eases, while at the same time protecting the well-being of their patients. O’Connor
concluded that although the links between microbial infections and chronic dis-
eases can be complex and multifactorial, they can be characterized—and benefi-
cial interventions against infection can be designed.

DEVELOPING VACCINES FOR

PREVENTION OF CHRONIC DISEASE
P. Helena Mäkelä, M.D., Ph.D.*
National Public Health Institute, Helsinki, Finland

The potential of vaccination as an intervention is undeniable. Vaccines have

*I wish to thank warmly colleagues whose contribution to this paper have been essential: Jenni M.
Vuola, Mirja Puolakkainen, Tuula Penttilä, Anne Sarén, Anu Haveri, and Laura Mannonen from the
Institute or Department of Virology, Haartman Institute, University of Helsinki.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

176 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

the unique record of totally eliminating or eradicating their target disease—small-

pox in the recent past, polio likely to happen in the near future.
The important point is that vaccination has a target separate and different
from the human body, thus making it possible to destroy the microbe without
harm to the host. Vaccination is an exciting novel concept for intervention in
chronic diseases arising from the realization of a link of many chronic conditions
with infectious agents.
A second aspect that sets vaccination apart from other interventions is that it
is based on acquired immunity, the powerful defense system of the mammalian
body. It provides a very sophisticated machinery for defense against the target
microbe; what vaccination needs to do is to enhance its activity and direct it to the
specified target.
Recent advances of molecular biology and genetics have provided vaccine
development with very powerful methods of research. These include the possi-
bilities offered by genomics and proteomics to detect the relevant antigens to
include in the vaccine and to identify the branches of immunity that should be
enhanced by the new vaccines. At least equally important are the advances re-
cently made and to be made in understanding the processes of acquired immunity
on one hand and of pathogenesis of the diseases—an interplay between the mi-
crobe and host—on the other. Also to be included here are new means of produc-
ing the desired vaccine antigens in a heterologous host, e.g., E. coli or yeast, thus
bypassing difficulties of growing a fastidious microbe or purifying a specific
protein. An even more sophisticated form of vaccination is administration, in-
stead of a vaccine antigen, its gene inserted in the genome of a viral or bacterial
vector or a naked piece of nucleic acid, relying on its expression in the vaccinated
individual. The advances in immunology suggest possibilities of developing novel
adjuvants to enhance or suppress selected responses. Increasing knowledge of
mucosal immunity may allow the development of more specific vaccines accord-
ing to the site of the microbial invasion to be prevented.
However, many problems and questions immediately arise:

1. How certain is the link of a chronic disease to the microbe suspected as

the culprit? A major barrier to vaccine development is not knowing how great an
investment is needed before a vaccine is on the market. Obviously the industry
will want to closely assess all information about the link when making decisions
of starting the development process or of continuing it throughout. The public
sector might be less sensitive to this kind of uncertainty, but it does not as a rule
have the capacity and know-how to carry out the full process of modern vaccine
development. On the other hand, on the competitive market, early start of the
development would be an important advantage.
2. What is known of the pathogenesis of the chronic disease and the infec-
tion behind it? Important questions with immediate relevance to vaccine develop-
ment are whether or not the chronic disease is dependent on the continued pres-

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

OPPORTUNITIES FOR PREVENTION AND MITIGATION 177

ence and persistence, of the microbe (as seems to be the case with gastric ulcer
associated with Helicobacter pylori infection) or mediated by a process once set
in motion or fully carried out by the microbe that then disappears (the latter may
be the case with juvenile diabetes due to destruction of islet cells associated with
a viral infection).
3. How does acquired immunity affect the condition? In case of persistent
infection we would need to know the characteristics of the immunity that allows
the infection to persist—which component is missing and why, how could we
change the situation to convert the persistence-associated immunity to a protec-
tive immunity? Would it be possible to affect this during the persistent state so
that the persistence could be cured? For vaccine development, the characteristics
of protective immunity for each infection would need to be known. Questions
that can be asked to help this characterization include the role of antibodies (if
yes, to which antigens? is high affinity essential? would some isotype be specifi-
cally needed?) and the role of T cells (and further, whether it is the CD4+ cells
stimulated by antigenic peptide bound to the MCH class II molecules on the
surface of antigen-presenting cells or the CD8+ cells stimulated by peptide bound
to class I molecules, and whether it should be a Th 1- or Th 2-type response, each
associated with its separate sets of cytokines).
4. Do we have an experimental animal model? The use of such a model is
normally an essential part of vaccine development that helps to convert the theo-
retical findings at the laboratory bench to a form on which we can predict what
can be expected of the vaccine’s performance in humans. The better the model,
the more we can learn about the candidate vaccine, and more importantly, about
the pathogenesis of the infection, the disease, and the immunity. Nevertheless, it
is also true that no animal experiments can replace final clinical trials in which
the vaccine is evaluated in its real target population.

Of the problems listed, the question of persistent infection requires special

attention as a feature not considered in the context of conventional vaccines.
Again, there are more open questions than facts. In order to persist, the microbe
will have to hide from both innate host defenses and the effector mechanisms of
acquired immunity. This raises a series of questions. Where exactly does this take
place? How can we identify—diagnose—a persistent infection? What are the host
factors that induce persistence and/or allow it to continue? What about the mi-
crobe? Is it dormant, with only a few genes active? If so, which ones are they and
what are their products (which might be the sought-after vaccine antigens)? The
intracellular space is protected from antibodies, and indeed utilized by most per-
sisting microbes. But then we need to ask in which cells, in which part of the body
(e.g., Herpes viruses in the nuclei of the neurons in sensoric ganglia), and in
which compartment of the cells? Intracellular bacteria most often enter via
phagocytic vacuoles, but can then further modify their microenvironment by regu-
lating the acidification of the vacuolar fluid, fusion with lysosomal granules, etc.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

178 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

Strategies for Vaccination to Prevent Chronic Disease

Associated with an Infectious Agent
The many varieties in which microbes may lead to chronic conditions sug-
gest that different strategies of vaccination will be needed. These can be classi-
fied as one of two basic types: one, preventing the primary acute infection, and
two, curing the persistent infection.
Prevention of acute infection has many advantages. It would not differ from
the established concept of vaccination. Vaccine development would be straight-
forward up to and including the clinical efficacy trial, in which the prevention of
the acute infection would be the outcome measured. Thus, one would not need to
worry about the pathogenesis of the chronic disease. The success of this approach
has indeed been demonstrated for the hepatitis B vaccine (reduction of chronic
hepatitis and liver cancer in 10 years following vaccination in infancy [Lee and
Ko, 1997]). This vaccine is now recommended by the World Health Organization
for use in the infant immunization program all over the world. An effective vacci-
nation program reaching a high coverage rate would also be likely to reduce the
transmission of the infectious agent and thereby lead to herd immunity further
enhancing the overall effect of the program. Vaccination of this type would seem
very attractive for prevention of infections that lead to the chronic disease rela-
tively early in life, e.g., for juvenile diabetes, if the connection to the infectious
agent is established and a vaccine available.
For a vaccine of this type to succeed it would need to be highly efficacious,
leading to full elimination of the infective agent and continued protection from
eventual new encounters. Specifically it should not allow persistence to develop,
and demonstration of this effect should be included in the final tests for vaccine
licensure. From a programmatic point of view this type of vaccine should be
administered before the infection is normally acquired, which usually means early
in infancy. This would not cause problems as such since most vaccinations now
take place within the infant immunization program, assuring an effective infra-
structure for vaccine delivery and good access to a high proportion of all children
born. However, the vaccine should be effective enough to provide protection up
to an advanced age—preferably through life, a fairly strict requirement. Further-
more, the main problem may lie in motivating the inclusion of one more vaccine
among the injections given to infants, if the intended benefits—prevention of a
chronic disease—will only be seen decades later.
The second alternative, curing an already established persistent infection,
would be an answer to the programmatic problem just described. The vaccine
could be given later in life, at a time when individuals start to worry about the
dangers of various chronic conditions affecting higher age groups. Motivation for
vaccination would be especially high among those who have already experienced
symptoms of the chronic disease. On the other hand, so far there is no established
infrastructure or system for reaching the adults who should be vaccinated, al-

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

OPPORTUNITIES FOR PREVENTION AND MITIGATION 179

though one is currently needed for efficient delivery of the annual influenza vac-
cine. However, the development of a vaccine capable of curing an established
persistent infection is a formidable challenge, and no such vaccine exists as a
model.

The Example of Cardiovascular Disease

The role of Chlamydia pneumoniae in atherosclerosis is supported by several
lines of evidence but has not been conclusively established (Saikku, 1999;
Grayston, 2000; O’Connor et al., 2001). This is a definite handicap for serious
investment in vaccine development. On the other hand, the disease is so prevalent
and well known as the major cause of death for those aged 40 years and above
that the potential market for a vaccine would be very lucrative. Therefore, let us
examine how a vaccine could be developed and used.
C. pneumoniae is an obligate intracellular gram-negative bacterium. It has a
small genome of approximately 1.2 million nucleotides fully sequenced. Its pri-
mary mode of transmission is via the respiratory route from man to man, and the
respiratory infection that develops is usually mild but can also progress to pneu-
monia. The first infection occurs in childhood and in early adolescence, repeated
infections are common. Fifty to seventy percent of adults are seropositive. There
is little accurate information about acquired immunity in man; antibody responses
are easily demonstrated to several antigens, and the same is true of T-cell re-
sponses. However, the immunity following infection does not prevent repeated
infections and allows the development of persistent infection. It is not clear
whether or not the immunity itself plays a critical role in the pathogenesis of the
cardiovascular disease.
There is quite a bit of evidence for persistence of C. pneumoniae after infec-
tion: it has been identified in peripheral blood mononuclear cells and in vascular
plaques of individuals with other osclerotic disease. The role and mechanisms of
action of the persistent bacteria in the pathogenesis of cardiovascular disease is
open—potential mechanisms suggested include local reactivation of the bacteria
with resulting local inflammation, activation of the blood coagulation system,
and induction of various cytokines either directly by the bacteria or their compo-
nents (especially lipopolysaccharide) or in conjunction with immune cells and/or
antibodies.
An experimental model of C. pneumoniae infection has been developed in
the mouse (Kaukoranta-Tolvanen et al., 1993; Penttilä et al., 1998). The acute
infection resulting from intranasal inoculation of moderate doses of C.
pneumoniae (105–106 inclusion forming units [IFUs]) resembles the human in-
fection in many ways. It is a pneumonia that is symptomatically mild. The bacte-
ria are seen in the lungs inside epithelial cells and macrophages; their numbers
stay high for 1–2 weeks and then decrease to undetectable (culture-negative) in
3–4 weeks. An immune response can be seen in antibody production and T-cell

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

180 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

responses. Most importantly, the infection results in partial protection seen on

reinfection when a similar intranasal inoculation results in a lower peak level of
IFUs and their disappearance in 1–2 weeks.
The role of different branches of the immune system has been studied in the
mouse model using gene-deleted mice as well as mice injected with antibodies to
deplete specific immune cells or interferon (Penttilä et al., 1999; Rottenberg et
al., 1999). These experiments have shown that the cure of the acute infection did
not require antibodies or either CD4+ of CD8+ T-cells; however, in more se-
verely deleted mice lacking both types of T cells cultivable bacteria continued to
be present in the lungs in relatively high numbers. Interferon gamma (INF-γ) was
identified as an important mediator. The protective immunity seen on reinfection
would be more relevant from the vaccine development point of view. The experi-
mental findings pointed at the central role of CD8+ cells in this protection: if they
were depleted, the reinfection proceeded at the same kinetics as the primary in-
fection. IFN-γ appeared to be a mediator of cure also in this phase. In summary,
consistent with the intracellular multiplication of C. pneumoniae, T cells, and,
especially CD8+ T cells, seem to have a key position in protective immunity.
A number of candidate vaccines have been prepared and tested for preven-
tion of the acute infection (Penttilä et al., 2000; Svanholm et al., 2000; Murdin et
al., 2000). Killed C. pneumoniae particles (EB, the infectious elementary bodies)
afforded partial protection that was less strong than seen during recovery from a
previous infection. Several C. pneumoniae genes given in the form of naked DNA
vaccines have likewise provided partial protection but again less strong than seen
in reinfection. The immune response to the products of the respective C.
pneumoniae genes were easily measurable as both antibody and T-cell responses,
including cytotoxic CD8+ lymphocytes (CTL). In the same approach, several
other genes have failed to induce protection.
The key determinants of protection in the acute infection model are still not
known. The prominent role of the intracellular life of C. pneumoniae is consistent
with the importance of CD8+ cells in protective immunity. The vaccines that so
far have given positive signals of protection have stimulated CD8+ cells. Then
why only incomplete protection? Is it due to us not having identified the right
antigen(s)? Quite possibly so: most of the C. pneumoniae gene products likely
remain within the body of the gram-negative bacterium, which further resides
within the intracellular vesicle known as inclusion body. Therefore only few pro-
teins would be likely to reach the cytoplasm of the host cell, a primary require-
ment in order to be processed, associated with the nascent MHC class I molecules
and presented by these on the cell surface essential for recognition by immune
CTLs. These proteins would most likely be protein(s) purposely exported by the
bacteria to interact with the host cell components and subvert these to the benefit
of the microbe. In other gram-negative bacteria, such proteins are typically se-
creted by a specific “Type III Secretion” machinery, and evidence is accumulat-

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

OPPORTUNITIES FOR PREVENTION AND MITIGATION 181

ing for the importance of the Type III system also in Chlamydiae (Fields and
Hackstadt, 2000; Bavoil et al., 2000).
In addition to hiding from the immune system by their intracellular lifestyle,
Chlamydiae have also developed a sophisticated mechanism for thwarting the
MHC-based immune recognition. This takes place by downregulation of the tran-
scription of both MHC class I and class II molecules; the downregulation is medi-
ated by specific degradation by C. pneumoniae-coded proteins of host cell factors
promoting the transcription (Zhong et al., 1999, 2000). This is an entirely novel
mechanism of immune evasion by pathogenic microbes, and certainly presents a
formidable challenge for vaccine development.
The immune recognition and subsequent killing of the infected cells is not
necessarily uniform for all cells; thus the infection may proceed or become per-
sistent in only a part of the initially infected cells. Then we are faced with the
likely possibility that antigen presentation in the persistently infected cells will
differ from that seen during the acute phase. Very likely, therefore, a vaccine
capable of preventing and curing the persistent infection will be different from
the one preventing the acute infection. The mouse model may be suitable for
studying the persistent infection, too. C. pneumoniae-specific DNA can be de-
tected by PCR for at least 2 months after cultures have turned negative, and the
dormant infection can be reactivated by immunosuppressive treatment of the mice
(Malinverni et al., 1995; Laitinen et al., 1996). Our experience with both methods
of detection suggests that persistence develops in part of the animals only, a fur-
ther point of resemblance to the human C. pneumoniae infection. Persistent infec-
tion can also be detected in vitro in cell cultures of C. pneumoniae (Byrne et al.,
2001; Pantoja et al., 2001). Such a mode of growth can be induced by treatment
of the culture with IFN-γ or sublethal doses of antibiotics or by depletion of
tryptophan. The morphology of the inclusion bodies in which C. pneumoniae
normally multiply and mature to the infectious EB forms changes and no EBs are
seen.
Crucial questions on the path to the development of a vaccine aimed at cur-
ing the persistent C. pneumoniae infection then include:

• Which C. pneumoniae proteins are produced during persistence?

• Which of them reach the cytoplasm?
• Are these processed for MHC class I presentation?
• Are the processed epitopes presented on the cell surface or is the C.
pneumoniae-mediated downregulation of MHC class I complete?
• Is the recognition by CD8+ cells efficient, leading to immunization?
• Is the recognition by specific CTLs efficient, leading to cell lysis or kill-
ing?
• Are there infected cells escaping the CTLs?

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

182 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

If we are lucky, answers to these questions as well as the large amount of

work devoted to developing vaccines for other Chlamydiae (C. trachomatis, C.
psittaci) may lead to the development of the desired vaccine for prevention of C.
pneumoniae-associated cardiovascular disease (Igietseme et al., 2002). However,
other questions remain. We would need to define how the vaccine will be used,
the main alternative being incorporation in the infant immunization program or
recommended to all at a certain age. If the former, who will pay for the cost of
vaccination to prevent a disease perhaps 50 years later? If the latter, will the
target be all individuals or only males, and at which age, 30 or 40 or 50 years?

REFERENCES
Bavoil PM, Hsia RC, Ojcius DM. 2000. Closing in on Chlamydia and its intracellular bag of tricks.
Microbiology 146:2713–2731.
Byrne GI, Ouellette SP, Wang Z, Rao JP, Lu L, Beatty WL, Hudson AP. 2001. Chlamydia pneumoniae
expresses genes required for DNA replication but not cytokinesis during persistent infection of
HEp-2 cells. Infection and Immunity 69:5423–5429.
Fields KA and Hackstadt T. 2000. Evidence for the secretion of Chlamydia trachomatis CopN by a
type III secretion mechanism. Molecular Microbiology 38:1048–1060.
Grayston JT. 2000. Background and current knowledge of Chlamydia pneumoniae and atherosclerosis.
The Journal of Infectious Diseases 181:S402–410.
Igietseme JU, Black CM, Caldwell HD. 2002. Chlamydia vaccines. Strategies and status. Biodrugs
16:19–35.
Kaukoranta-Tolvanen S-SE, Laurila AL, Saikku P, Leinonen M, Liesirova L, Laitinen K. 1993.
Experimental infection of Chlamydia pneumoniae in mice. Microbial Pathogenesis 15:293.
Laitinen K, Laurila AL, Leinonen M, Saikku P. 1996. Reactivation of Chlamydia pneumoniae infec-
tion in mice by cortisone treatment. Infection and Immunity 64:1488–1490.
Lee CL and Ko YC. 1997. Hepatitis B vaccination and hepatocellular carcinoma in Taiwan. Pediat-
rics 99:351–353.
Malinverni R, Kuo CC, Campbell LA, Grayston JT. 1995. Reactivation of Chlamydia pneumoniae
lung infection in mice by cortisone. The Journal of Infectious Diseases 172:593–594.
Murdin AD, Dunn P, Sodoyer R, Wang J, Caterini J, Brunham RC, Aujame L, Oomen R. 2000. Use
of a mouse lung challenge model to identify antigens protective against Chlamydia pneumoniae
lung infection. The Journal of Infectious Diseases 181(Suppl 3):S544–551.
O’Connor S, Taylor C, Lee AC, Epstein S, Libby P. 2001. Potential infectious etiologies of athero-
sclerosis: A multifactorial perspective. Emerging Infectious Diseases 7:780–788.
Pantoja LG, Miller RD, Ramirez JA, Molestina RE, Summersgill JT. 2001. Characterization of
Chlamydia pneumoniae persistence in HEp-2 cells treated with gamma interferon. Infection and
Immunity 69:7927–7932.
Penttilä JM, Anttila M, Puolakkainen M, Laurila A, Varkila K, Sarvas M, Mäkelä PH, Rautonen N.
1998. Local immune responses to Chlamydia pneumoniae in the lungs of BALB/c mice during
primary infection and reinfection. Infection and Immunity 66:5113–5118.
Penttilä JM, Anttila M, Varkkila K, Puolakkainen M, Sarvas M, Mäkelä PH, Rautonen N. 1999.
Depletion of CD8+ cells abolishes memory in acquired immunity against Chlamydia
pneumoniae in BALB/c mice. Immunology 97:490–496.
Penttilä T, Vuola JM, Puurula V, Anttila M, Sarvas M, Rautonen N, Mäkelä PH, Puolakkainen M.
2000. Immunity to Chlamydia pneumoniae induced by vaccination with DNA vectors express-
ing a cytoplasmic protein (Hsp60) or outer membrane proteins (MOMP and Omp2). Vaccine
19:1256–1265.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

OPPORTUNITIES FOR PREVENTION AND MITIGATION 183

Rottenberg ME, Rotfuchs ACG, Gigliotti D, Svanholm C, Bandholtz L, Wigzell HJ. 1999. Role of
innate and adaptive immunity in the outcome of primary infection with Chlamydia pneumoniae,
as analyzed in genetically modified mice. The Journal of Immunology 162:2829–2836.
Saikku P. 1999. Epidemiology of Chlamydia pneumoniae in atherosclerosis. American Heart Journal
138:S500–503.
Svanholm C, Bandholtz L, Castanos-Velez E, Wigzell H, Rottenberg ME. 2000. Protective DNA
immunization against Chlamydia pneumoniae. Scandinavian Journal of Immunology 51:345–
353.
Zhong G, Fan T, Liu L. 1999. Chlamydia inhibits interferon γ-inducible major histocompatibility
complex class II expression by degradation of upstream stimulatory factor 1. The Journal of
Experimental Medicine 189:1931–1938.
Zhong G, Liu L, Fan T, Fan P, Ji H. 2000. Degradation of transcription factor RFX5 during the
inhibition of both constitutive and interferon γ-inducible major histocompatibility complex class
I expression in Chlamydia-infected cells. The Journal of Experimental Medicine 191:1525–
1534.

TOWARD A STRATEGIC APPROACH: INTEGRATING

EPIDEMIOLOGY, LABORATORY RESEARCH, AND
SURVEILLANCE; SETTING PRIORITIES
Siobhán O’Connor, M.D., M.P.H.
Assistant to the Director of the National Center for Infectious Diseases
[For Infectious Causes of Chronic Diseases]
Centers for Disease Control and Prevention, Atlanta, GA

Evidence that microbes are at the root of chronic conditions such as peptic
ulcer disease, Whipple’s disease, hepatocellular carcinoma, and cervical cancer
has transformed medicine. These examples underscore the plausibility that infec-
tious agents might be linked to numerous other non-communicable chronic con-
ditions. Indeed, research into speculative and as yet to be proposed associations
can no longer be viewed as “fishing expeditions,” despite the investigative chal-
lenges. Strategies that use collaborations to enhance the productivity of indepen-
dent investigators, integrate rigorously executed laboratory techniques into well-
designed epidemiologic studies and surveillance systems, and complement
short-term studies with long-term follow-up can overcome the hurdles to create
new prevention and intervention opportunities. Balancing research on potential
infectious links for common chronic conditions, in which the contribution of mi-
crobes to overall burden could be minor, with that on less common diseases,
perhaps likely to have a primary infectious cause, could benefit many.

The Basics
Certain basic tenets, however, are crucial to successfully defining, character-
izing, and mitigating the burden of chronic diseases that is induced by infectious
diseases. Widespread use of standardized or comparable case definitions—for the

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

184 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

infection and the outcome—is needed for comparisons across studies and conclu-
sions on causality. So, too, are universally high standards of specificity, sensitiv-
ity, and reproducibility in laboratory assays, applied to appropriate specimens
and controls. Minimum performance criteria are feasible, even when investigator
creativity enters uncharted territory or population and exposure differences im-
pact reproducibility. Peer review journals can reinforce these standards if publi-
cation depends upon the use of sound epidemiologic design and laboratory assays
capable of supporting the conclusions.

Building on the Basics

From these basics, integration and complementation of laboratory elements
with epidemiologic studies and surveillance systems can clarify new and sus-
pected associations. However, this will require greater investment in:

• Pathogen discovery activities that: identify novel agents, define which species
of known agents impart chronic sequelae, and detect agents in alternative tissues;
• Development of new and improved laboratory technologies to advance
pathogen discovery and the detection of known agents;
• Expansion of viral screening methodology; and
• Continued development of improved, more sensitive and specific labora-
tory diagnostic assays that can identify an infectious root of disease at the site of
pathology or a distant site, and distinguish active from latent or past infection.

Demonstrated in HIV/AIDS, human herpesvirus 8-associated Kaposi’s sar-

coma and Chlamydia trachomatis-related reactive arthritis, among others, obser-
vational and applied (laboratory) epidemiology remain powerful tools by which
to recognize infection-chronic disease associations. Therefore, just as vital will
be a parallel investment in epidemiology that emphasizes:
• Linking of databases—for infection-chronic disease associations, infec-
tious diseases, and chronic syndromes—designed or modified to be compatible;
• Observational epidemiology to identify clusters and trends;
• Application of validated pathogen discovery technology to further de-
scribe the epidemiology of infections and identify potential infection-chronic dis-
ease links;
• Achieving balance between cross-sectional studies and longitudinal co-
horts of individuals affected and unaffected by a chronic disease, including those
infected and uninfected;
• Longitudinal follow-up of infectious exposures through surveillance sys-
tems (e.g., state-based FoodNet surveillance) and cohorts of recently infected
people; and
• Banking specimens for analysis with future technology and to study newly
proposed etiologic associations.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

OPPORTUNITIES FOR PREVENTION AND MITIGATION 185

As these options are considered, it will be important to plan, prioritize, and

invest in research that addresses certain key issues, including studies that:

• Define temporal relationships between infection and disease, the stage of

infection that determines chronic outcome (e.g., first infection, re-infection, per-
sistent infection, co-infections, or a subsequent cross-reacting infection);
• Clarify the stage at which infection must be prevented or treated to mini-
mize or eliminate chronic sequelae—intervention should decrease the chronic
disease burden;
• Support multi-center/multi-investigator collaborations that pool findings
with comparable case-definitions, study designs, and validated laboratory assays
to increase the power and statistical significance of results;
• Initiate or expand existing multi-national and multi-racial/ethnic studies
that can identify groups at high risk for infection-related chronic sequelae (be-
cause of genetic, environmental, cultural, or multifactorial predisposition); and
• As appropriate, expand cohorts and specimen sampling in established sys-
tems (e.g., NHANES) in order to study less common conditions and high risk
populations OR establish new networks, building on systems such as managed
care organizations.

Complementary to these issues will be questions of etiopathogenesis. By

what process(es) does infection influence chronic sequelae? For some associa-
tions, it will be important to first identify the links and potential interventions,
later elucidating the pathway from infection to disease. In other situations, under-
standing mechanisms of pathogenesis can spur research to consider microbial
roots of disease. This is certain to be a dynamic area in which a balanced ap-
proach may be the most productive.

Overarching Issues
Strategies that build on fundamentals of sound science are likely to identify
and clarify additional infectious disease-chronic disease links, confirming this
arena to be both our challenge and our future. Some investments of today may
yield early answers, while other returns may take years. That is the nature of the
unknown and of chronic conditions. However, the potential benefits of these in-
vestments to populations and to individuals are great—greatest if investment be-
gins now. As the field expands two additional, crosscutting issues call for con-
tinuous consideration:

• To capitalize on the benefits afforded by confirmed and newly discovered

infection-chronic disease links, medical education (training and continuing edu-
cation) must improve recognition of known and potential links, the attendant in-
tervention opportunities, and the cautions against inappropriate therapies; and

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

186 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

• The potential changes that population migrations and individual travel

impart on the distribution and character of even established associations create an
ongoing need for surveillance.

Although the links between infectious diseases and chronic diseases can be
complex and multifactorial, they can be characterized, and beneficial interven-
tions against infection designed. Most fruitful is an approach that increases in-
vestments in the laboratory, epidemiology, and surveillance, emphasizing inte-
gration of these elements and collaborations that can increase the yield of research
and medical science.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

Appendix
A

Workshop Agenda

LINKING INFECTIOUS AGENTS AND CHRONIC DISEASES:

Defining the Relationship, Enhancing the Research,

and Mitigating the Effects

October 21–22, 2002

Room 100
The National Academies
500 Fifth Street, NW
Washington, DC 20001

AGENDA

MONDAY, OCTOBER 21, 2002

8:30 a.m. Continental Breakfast

9:00 Welcome and Opening Remarks

Adel Mahmoud, Chair, Forum on Microbial Threats
Stanley Lemon, Vice Chair, Forum on Microbial Threats

Session I
Case Studies of Infectious Agents Associated with Chronic Diseases
Evidence continues to mount implicating microorganisms as etiologic agents of
chronic diseases that contribute to substantial mortality and morbidity. This ses-
sion will examine definitive and emerging associations between infectious agents
and chronic diseases with a range of pathogenic mechanisms and diversity in
etiologic microbes. The review will explore advances in research, detection, and

187

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

188 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

screening that have contributed to these discoveries and some of the challenges
that remain.

9:15 Human papillomavirus infection as the cause of

cervical cancer
Eduardo Franco, McGill University

9:45 Infectious agents and cardiovascular disease

Michael Dunne, Pfizer, Inc.

10:15 Infectious agents and demyelinating diseases

Richard Johnson, Johns Hopkins University School of Medicine

10:45 The role of infectious agents in schizophrenia, bipolar

disorder, and other serious neuropsychiatric diseases
Robert Yolken and E. Fuller Torrey, Johns Hopkins University
School of Medicine and Stanley Foundation

11:15 BREAK

11:30 Common infections and uncommon disease: Elusive

associations of enteroviruses and type I diabetes mellitus
Mark Pallansch, Centers for Disease Control and Prevention

12:00 p.m. Chronic hepatitis B virus infections

William Mason, Fox Chase Cancer Center

12:30 Retrovirus-induced lung cancer in sheep:

Perspectives on the human disease
Hung Fan, University of California, Irvine

1:00 LUNCH

Session II
Challenges in Framing the Research
Identification and confirmation of the infectious causation of chronic dis-
eases are complicated by several factors, which include detection of microbes at
the time of diagnosis of the chronic condition, the lack of adequate methods to
identify novel or rare microorganisms, and the influence of environmental and
genetic factors on the etiology of the chronic diseases. This session will examine
these challenges and identify existing and potential methods and technologies for
overcoming these obstacles.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

APPENDIX A 189

2:00 Kaposi’s sarcoma, KSHV and causality: Koch’s postulates in

the age of molecular biology
Patrick Moore, Mailman School of Public Health,
Columbia University

2:30 Microbial agents in chronic diseases: Guilt by association

versus pathologic etiology
Thomas Quinn, Johns Hopkins University School of Medicine

3:00 Novel diagnostic, therapeutic, and chemopreventive strategies

David Persing, Corixa Corporation

3:30 BREAK

Session III
Discussion Panel: Shaping the Research and Development Agenda

3:45 Panel members, Forum members, and the audience will comment on and
respond to considerations such as the role of industry in developing diagnostics;
possibilities for the coordination between basic and clinical scientists, patholo-
gists, and epidemiologists in developing standardized specific case definitions
and specimens and the development of comparable methods of analysis; the les-
sons that can be learned about the microbes from the chronic sequelae they pro-
duce; and methods for funding the research.

David Morens, National Institute of Allergy and Infectious

Diseases
Ian Lipkin, University of California, Irvine, and Mailman School
of Public Health, Columbia University
Susan Swedo, National Institute of Mental Health

5:30 Adjournment of the first day

TUESDAY, OCTOBER 22, 2002

8:30 a.m. Continental Breakfast

9:00 Opening Remarks

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

190 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

Session IV
Implications for Developing Countries
As researchers, clinicians, and policymakers have recognized the growing
disease burden from chronic diseases in developing countries, understanding of
the infectious etiology of these diseases becomes increasingly important in these
areas where many infectious diseases still remain endemic. This session will
review the consequences of highly prevalent infectious diseases linked to chronic
diseases and explore the global and local response needed to combat these out-
comes in resource-limited environments.

9:15 Interaction of multiple infectious agents in endemic areas

Altaf Lal, Centers for Disease Control and Prevention

9:45 Progression of hepatitis C virus infection with and without

schistosomiasis
Sanaa Kamal, Ain Shams University, Cairo, Egypt

10:15 Infectious agents and epilepsy

J.W.A.S. Sander, Institute of Neurology, University College,
London

10:45 Potential long-term consequences of early childhood enteric

and parasitic infections
Richard Guerrant, University of Virginia School of Medicine

11:15 HTLV-1: Clinical impact of chronic infection

Eduardo Gotuzzo, University of Peru, Lima, Peru

12:00 p.m. LUNCH

Session V
Barriers and Opportunities to Detect, Prevent, and Mitigate the Impact of
Chronic Diseases Caused by Infectious Agents
The complexity of the relationship between infectious agents and chronic
diseases requires a multi-disciplinary approach to reveal the implications of early
detection and prevention of chronic diseases caused by infectious agents. This
session will summarize the advances and gaps in collaborative research on detec-
tion and diagnostic technologies, their integration with epidemiological studies
and surveillance that can forward the efforts in this important area, and the impli-
cations for clinical management practices and priorities.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

APPENDIX A 191

1:00 Testing the reliability of the causal relationship: Considering

genetic and environmental susceptibility
Mikhail Pletnikov, Johns Hopkins University School of Medicine

1:30 DNA sequence analysis of a stealth-adapted simian

cytomegalovirus
W. John Martin, Center for Complex Infectious Diseases

2:00 Development of vaccines to prevent chronic disease

P. Helena Mäkelä, National Public Health Institute,
Helsinki, Finland

2:30 Integrating epidemiology, laboratory research, and

surveillance
Siobhán O’Connor, Centers for Disease Control and Prevention

3:00 BREAK

Session VI
Discussion Panel: The Next Steps for the Healthcare Community
Panel members, Forum members, and the audience will comment on and
respond to considerations such as the role of industry and academic research in
developing treatments; the implications for the health care and prevention com-
munity in detecting and treating these diseases; and the benefits of managing
acute infections vs. chronic diseases—the argument for vaccines and antimicro-
bials.

3:15 Kathryn Carbone, FDA, Center for Biologics Evaluation and

Research
Thomas Shinnick, Centers for Disease Control and Prevention

5:00 Closing Remarks / Adjournment

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

Appendix
B

Information Resources

OVERVIEW
Danesh J, Newton R, Beral V. 1997. A human germ project? Nature 389:21–24.
Mueller N. 1995. Overview: viral agents and cancer. Environmental Health Perspectives 103:259–
261.
Parsonnet J. 1995. Bacterial infection as a cause of cancer. Environmental Health Perspectives 103
Suppl 8:263–268.
Persing DH and Prendergast FG. 1999. Infection, immunity, and cancer. Archives of Pathology &
Laboratory Medicine 123:1015–1022.

CAUSAL ASSOCIATIONS
Commission on Tropical Diseases of the International League Against Epilepsy. 1994. Relationship
between epilepsy and tropical diseases. Epilepsia 35:89–93.
Durkin MS, Khan NZ, Davidson LL, Huq S, Munir S, Rasul E, Zaman SS. 2000. Prenatal and post-
natal risk factors for mental retardation among children in Bangladesh. American Journal of
Epidemiology 152:1024–1033.
El-Serag HB and Mason AC. 2000. Risk factors for the rising rates of primary liver cancer in the
United States. Archives of Internal Medicine 160:3227–3230.
Epstein SE, Zhou YF, Zhu J. 1999. Infection and atherosclerosis: emerging mechanistic paradigms.
Circulation 100:E20–E28.
Franco EL, Duarte-Franco E, Ferenczy A. 2001. Cervical cancer: epidemiology, prevention, and the
role of human papillomavirus infection. Canadian Medical Association Journal 164:1017–1025.
Gilden DH, Burgoon MP, Kleinschmidt-DeMasters BK, Williamson RA, Ghausi O, Burton DR,
Owens GP. 2001. Molecular immunologic strategies to identify antigens and β-cell repsonses
unique to multiple sclerosis. Archives of Neurology 58:43–48.
Johnson RT. 1994. The virology of demyelinating diseases. Annals of Neurology 36 Suppl:S54–S60.

192

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

APPENDIX B 193

Lipkin WI, Hornig M, Briese T. 2001. Borna disease virus and neuropsychiatric disease—a reappraisal.
Trends in Microbiology 9:295–298.
Maeda N, Palmarini M, Murgia C, Fan H. 2001. Direct transformation of rodent fibroblasts by
jaaagsiekte sheep retrovirus DNA. Proceedings of the National Academy of Sciences 98:4449–
4454.
Morris JA. 1995. Schizophrenia, bacterial toxins and the genetics of redundancy. Medical Hypotheses
46:362–366.
Roivainen M, Rasilainen S, Ylipaasto P, Nissinen R, Ustinov J, Bouwens L, Eizirik DL, Hovi T,
Otonkoski T. 2000. Mechanism of coxsackievirus-induced damage to human pancreatic β-cells.
The Journal of Clinical Endocrinology and Metabolism 85:432–440.
Scott MR, Will R, Ironside J, Nguyen HO, Tremblay P, DeArmond SJ, Prusiner SB. 1999. Compel-
ling transgenetic evidence for transmission of bovine spongiform encephalopathy prions to
humans. Proceedings of the National Academy of Sciences 96:15137–15142.
Stuver S. 1998. Towards global control of liver cancer? Seminars in Cancer Biology 8:299–306.
Swedo SE, Leonard HL, Garvey M, Mittleman B, Allen AJ, Perlmutter S, Lougee L, Dow S, Zamkoff
J, Dubbert BK. 1998. Pediatric autoimmune neuropsychiatric disorders associated with strepto-
coccal infections: clinical description of the first 50 cases. American Journal of Psychiatry
155:264–271.
Yolken RH, Karlsson H, Yee F, Johnston-Wilson NL, Torrey EF. 2000. Endogenous retroviruses and
schizophrenia. Brain Research Reviews 31:193–199.

TOOLS FOR RESEARCH

Fredricks DN and Relman DA. 1996. Sequence-based identification of microbial pathogens: a recon-
sideration of Koch's postulates. Clinical Microbiology Reviews 9:18–33.
Lisitsyn NA. 1995. Representational difference analysis: finding the differences between genomes.
Trends in Genetics 11:303–307.
Relman DA and Falkow S. 2001. The meaning and impact of the human genome sequence for micro-
biology. Trends in Microbiology 9:206–208.

IMPLICATIONS FOR DETECTION AND INTERVENTION

de The G. 1995. Viruses and human cancers: challenges for preventive strategies. Environmental
Health Perspectives 103:269–273.
Humphrey RW, Davis DA, Newcomb FM, Yarchoan R. 1998. Human herpesvirus 8 (HHV-8) in the
pathogenesis of Kaposi's sarcoma and other diseases. Leukemia and Lymphoma 28:255–264.
Makela PH. 1999. Is cardiovascular disease preventable by vaccination? Annals of Medicine 31:61–
65.
Munoz N and Bosch FX. 1996. The causal link between HPV and cervical cancer and its implications
for prevention of cervical cancer. Bulletin of the Pan American Health Organization 30:362–
377.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

Appendix
C

Biosketches

MEMBERS OF THE FORUM ON MICROBIAL THREATS

ADEL A.F. MAHMOUD, M.D., Ph.D., (Chair), is President of Merck Vac-
cines at Merck & Co., Inc. He formerly served Case Western Reserve University
and University Hospitals of Cleveland as Chairman of Medicine and Physician-
in-Chief from 1987 to 1998. Prior to that, Dr. Mahmoud held several positions,
spanning 25 years, at the same institutions. Dr. Mahmoud and his colleagues
conducted pioneering investigations on the biology and function of eosinophils.
He prepared the first specific anti-eosinophil serum, which was used to define the
role of these cells in host resistance to helminthic infections. Dr. Mahmoud also
established clinical and laboratory investigations in several developing countries,
including Kenya, Egypt, and The Philippines, to examine the determinants of
infection and disease in schistosomiasis and other infectious agents. This work
led to the development of innovative strategies to control those infections, which
have been adopted by the World Health Organization (WHO) as selective popu-
lation chemotherapy. In recent years, Dr. Mahmoud turned his attention to devel-
oping a comprehensive set of responses to the problems associated with emerging
infections in the developing world. He was elected to membership of the Ameri-
can Society for Clinical Investigation in 1978, the Association of American Phy-
sicians in 1980, and the Institute of Medicine of the National Academy of Sci-
ences in 1987. He received the Bailey K. Ashford Award of the American Society
of Tropical Medicine and Hygiene in 1983, and the Squibb Award of the Infec-
tious Diseases Society of America in 1984. Dr. Mahmoud is a member of the
Institute of Medicine and its Board on Global Health. He also chairs the U.S.
Delegation to the U.S.–Japan Cooperative Medical Science Program.

194

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

APPENDIX C 195

STANLEY M. LEMON, M.D., (Vice-chair), is Dean of the School of Medicine

at the University of Texas Medical Branch at Galveston. He received his under-
graduate degree in biochemical sciences from Princeton University summa cum
laude and his M.D. with honors from the University of Rochester. He completed
postgraduate training in internal medicine and infectious diseases at the Univer-
sity of North Carolina at Chapel Hill, and is board-certified in both areas. From
1977 to 1983, he served with the U.S. Army Medical Research and Development
Command, directing the Hepatitis Laboratory at the Walter Reed Army Institute
of Research. He joined the faculty of the University of North Carolina School of
Medicine in 1983, serving first as Chief of the Division of Infectious Diseases,
and then Vice Chair for Research of the Department of Medicine. In 1997, Dr.
Lemon moved to the University of Texas Medical Branch as Professor and Chair
of the Department of Microbiology & Immunology. He was subsequently ap-
pointed Dean pro tem of the School of Medicine in 1999, and permanent Dean of
Medicine in 2000. Dr. Lemon’s research interests relate to the molecular virology
and pathogenesis of the positive-stranded RNA viruses responsible for hepatitis
C and hepatitis A. He is particularly interested in the molecular mechanisms con-
trolling replication of these RNA genomes and related mechanisms of disease
pathogenesis. In addition, he has a longstanding interest in vaccine development.
Dr. Lemon has published more than 180 papers and numerous textbook chapters
related to hepatitis and other viral infections. He chaired the Anti-Infective Drugs
Advisory Committee and the Vaccines and Related Biologics Advisory Commit-
tee of the U.S. Food and Drug Administration, as well as the Steering Committee
on Hepatitis and Poliomyelitis of WHO’s Programme on Vaccine Development.
From 2000 to 2002, he chaired the Institute of Medicine (IOM) Committee on a
Strategy for Minimizing the Impact of Naturally Occurring Infectious Diseases
of Military Importance. At present, he is chairman of the U.S. Hepatitis Panel of
the U.S.–Japan Cooperative Medical Science Program and cochair of the IOM/
NRC Committee on Advances in Technology and the Prevention of their Appli-
cation to Next Generation Biowarfare Agents.

DAVID ACHESON, M.D., is Chief Medical Officer at the Center for Food
Safety and Applied Nutrition, U.S. Food and Drug Administration. He received
his medical degree at the University of London. After completing internships in
general surgery and medicine, he continued his postdoctoral training in Manches-
ter, England, as a Wellcome Trust Research Fellow. He subsequently was a
Wellcome Trust Training Fellow in Infectious Diseases at the New England Medi-
cal Center and at the Wellcome Research Unit in Vellore, India. Dr. Acheson was
Associate Professor of Medicine, Division of Geographic Medicine and Infec-
tious Diseases, New England Medical Center until 2001. He then joined the fac-
ulties of the Department of Epidemiology and Preventive Medicine and Depart-
ment of Microbiology and Immunology at the University of Maryland Medical
School. Currently at the FDA, his research concentration is on foodborne patho-

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

196 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

gens and encompasses a mixture of molecular pathogenesis, cell biology, and

epidemiology. Specifically, his research focuses on Shiga toxin-producing E. coli
and understanding toxin interaction with intestinal epithelial cells using tissue
culture models. His laboratory has also undertaken a study to examine Shiga
toxin-producing E. coli in food animals in relation to virulence factors and anti-
microbial resistance patterns. More recently, Dr. Acheson initiated a project to
understand the molecular pathogenesis of Campylobacter jejuni. Other studies
have undertaken surveillance of diarrheal disease in the community to determine
causes, outcomes, and risk factors of unexplained diarrhea. Dr. Acheson has
authored or coauthored more than 72 journal articles, and 42 book chapters and
reviews, and is coauthor of the book Safe Eating (Dell Health, 1998). He is re-
viewer of more than 10 journals and is on the editorial board of Infection and
Immunity and Clinical Infectious Diseases. Dr. Acheson is a Fellow of the Royal
College of Physicians, a Fellow of the Infectious Disease Society of America,
and holds several patents.

STEVEN J. BRICKNER, Ph.D., is Research Advisor, Antibacterials Chemis-

try, at Pfizer Global Research and Development. He received his Ph.D. in organic
chemistry from Cornell University and was a National Institutes of Health (NIH)
Postdoctoral Research Fellow at the University of Wisconsin–Madison. Dr. Brickner
is a medicinal chemist with nearly 20 years of research experience in the pharma-
ceutical industry, all focused on the discovery and development of novel anti-
bacterial agents. The inventor or coinventor on 21 U.S. patents, he has published
numerous scientific papers, primarily on oxazolidinones. Prior to joining Pfizer
in 1996, he led a team at Pharmacia and Upjohn that discovered and developed
linezolid, the first member of a new class of antibiotics to be approved in the last
35 years.

NANCY CARTER-FOSTER, M.S.T.M., is Senior Advisor for Health Affairs

for the U.S. Department of State, Assistant Secretary for Science and Health and
the Secretary’s Representative on HIV/AIDS. She is responsible for identifying
emerging health issues and making policy recommendations for USG foreign
policy concerns regarding international health, and coordinates the Department’s
interactions with the nongovernmental community. She is a member of the
National Academy of Sciences Institute of Medicine’s Forum on Infectious Dis-
eases, and a member of the Infectious Diseases Society of America (IDSA), and
the American Association of the Advancement of Science (AAAS). She has
helped bring focus to global health issues in U.S. foreign policy and brought a
national security focus to global health. In prior positions as Director for Con-
gressional and Legislative Affairs for the Economic and Business Affairs Bureau
of the U.S. Department of State, and Foreign Policy Advisory to the Majority
WHIP U.S. House of Representatives, Trade Specialist Advisor to the House of
Representatives Ways and Means Trade Subcommittee, and consultant to the

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

APPENDIX C 197

World Bank, Asia Technical Environment Division, Ms. Carter-Foster has worked
on a wide variety of health, trade and environmental issues amassing in-depth
knowledge and experience in policy development and program implementation.

GAIL H. CASSELL, Ph.D., is Vice President, Scientific Affairs, Distinguished

Lilly Research Scholar for Infectious Diseases, Eli Lilly & Company. Previously,
she was the Charles H. McCauley Professor and (since 1987) Chair, Department
of Microbiology, University of Alabama Schools of Medicine and Dentistry at
Birmingham, a department which, under her leadership, has ranked first in re-
search funding from the National Institutes of Health since 1989. She is a mem-
ber of the Director’s Advisory Committee of the Centers for Disease Control and
Prevention. Dr. Cassell is past president of the American Society for Microbiol-
ogy (ASM) and is serving her third three-year term as chairman of the Public and
Scientific Affairs Board of ASM. She is a former member of the National Insti-
tutes of Health Director’s Advisory Committee and a former member of the Ad-
visory Council of the National Institute of Allergy and Infectious Diseases. She
has also served as an advisor on infectious diseases and indirect costs of research
to the White House Office on Science and Technology and was previously chair
of the Board of Scientific Counselors of the National Center for Infectious Dis-
eases, Centers for Disease Control and Prevention. Dr. Cassell served eight years
on the Bacteriology-Mycology-II Study Section and served as its chair for three
years. She serves on the editorial boards of several prestigious scientific journals
and has authored more than 275 articles and book chapters. She has been inti-
mately involved in the establishment of science policy and legislation related to
biomedical research and public health. Dr. Cassell has received several national
and international awards and an honorary degree for her research on infectious
diseases.

JESSE L. GOODMAN, M.D., M.P.H., was professor of medicine and Chief of

Infectious Diseases at the University of Minnesota, and is now the Deputy Direc-
tor for the U.S. Food and Drug Administration’s (FDA) Center for Biologics
Evaluation and Research, where he is active in a broad range of scientific, public
health, and policy issues. After joining the FDA commissioner’s office, he has
worked closely with several centers and helped coordinate FDA’s response to the
antimicrobial resistance problem. He was co-chair of a recently formed federal
interagency task force which developed the national Public Health Action Plan
on antimicrobial resistance. He graduated from Harvard College and attended the
Albert Einstein College of Medicine followed by internal medicine, hematology,
oncology, and infectious diseases training at the University of Pennsylvania and
University of California Los Angeles, where he was also chief medical resident.
He received his master’s of public health from the University of Minnesota. He
has been active in community public health activities, including creating an envi-
ronmental health partnership in St. Paul, Minnesota. In recent years, his

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

198 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

laboratory’s research has focused on the molecular pathogenesis of tickborne dis-

eases. His laboratory isolated the etiological intracellular agent of the emerging
tickborne infection, human granulocytic ehrlichiosis, and identified its leukocyte
receptor. He has also been an active clinician and teacher and has directed or
participated in major multicenter clinical studies. He is a Fellow of the Infectious
Diseases Society of America and, among several honors, has been elected to the
American Society for Clinical Investigation.

EDUARDO GOTUZZO, M.D., is Principal Professor and Director at the

Instituto de Medicina Tropical “Alexander von Humbolt,” Universidad Peruana
Cayetan Heredia (UPCH), in Lima, Peru. He is also Chief of the Department of
Infectious and Tropical Diseases at the Cayetano Heredia Hospital and an Ad-
junct Professor of Medicine at the University of Alabama–Birmingham School of
Medicine. Dr. Gotuzzo has been an active member of numerous international
societies such as the Latin America Society of Tropical Disease (President, 2000–
2003), the Scientific Program of Infectious Diseases Society of America (2000–
2003), the International Organizing Committee of the International Congress of
Infectious Diseases (1994–present), the International Society for Infectious Dis-
eases (President Elect, 1996–1998), and the Peruvian Society of Internal Medi-
cine (President, 1991–1992). He has published more than 230 articles and chap-
ters as well as 6 manuals and 1 book. Among the many recent honors and awards
he has received, he was named an Honorary member of American Society of
Tropical Medicine and Hygiene (2002), an Associated Member of National Acad-
emy of Medicine (2002), an Honorary Member of Society of Internal Medicine
(2000), a Distinguished Visitor, Faculty of Medical Sciences, University of
Cordoba, Argentina (1999), and the receipient of the Golden Medal for Outstand-
ing Contribution in the field of Infectious Diseases from Trnava University,
Slovakia (1998).

MARGARET A. HAMBURG, M.D., is Vice President for Biological Programs

at Nuclear Threat Initiative (NTI), a charitable organization working to reduce
the global threat from nuclear, biological, and chemical weapons. Dr. Hamburg is
in charge of the biological program area. Before taking on her current position,
Dr. Hamburg was the Assistant Secretary for Planning and Evaluation, U.S.
Department of Health and Human Services, serving as a principal policy advisor
to the Secretary of Health and Human Services with responsibilities including
policy formulation and analysis, the development and review of regulations and
legislation, budget analysis, strategic planning, and the conduct and coordination
of policy research and program evaluation. Prior to this, she served for almost six
years as the Commissioner of Health for the City of New York. As chief health
officer in the nation’s largest city, Dr. Hamburg’s many accomplishments in-
cluded the design and implementation of an internationally recognized tuberculo-
sis control program that produced dramatic declines in tuberculosis cases; the

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

APPENDIX C 199

development of initiatives that raised childhood immunization rates to record lev-

els; and the creation of the first public health bioterrorism preparedness program
in the nation. She completed her internship and residency in Internal Medicine at
the New York Hospital/Cornell University Medical Center and is certified by the
American Board of Internal Medicine. Dr. Hamburg is a graduate of Harvard
College and Harvard Medical School. She currently serves on the Harvard Uni-
versity Board of Overseers. She has been elected to membership in the Institute
of Medicine, the New York Academy of Medicine, and the Council on Foreign
Relations, and is a Fellow of the American Association for the Advancement of
Science and the American College of Physicians.

CAROLE A. HEILMAN, Ph.D., is Director of the Division of Microbiology

and Infectious Diseases (DMID) of the National Institute of Allergy and Infec-
tious Diseases (NIAID). Dr. Heilman received her bachelor’s degree in biology
from Boston University in 1972, and earned her master’s degree and doctorate in
microbiology from Rutgers University in 1976 and 1979, respectively. Dr.
Heilman began her career at the National Institutes of Health as a postdoctoral
research associate with the National Cancer Institute where she carried out re-
search on the regulation of gene expression during cancer development. In 1986,
she came to NIAID as the influenza and viral respiratory diseases program officer
in DMID and, in 1988, she was appointed chief of the respiratory diseases branch
where she coordinated the development of acellular pertussis vaccines. She joined
the Division of AIDS as deputy director in 1997 and was responsible for develop-
ing the Innovation Grant Program for Approaches in HIV Vaccine Research. She
is the recipient of several notable awards for outstanding achievement. Through-
out her extramural career, Dr. Heilman has contributed articles on vaccine design
and development to many scientific journals and has served as a consultant to the
World Bank and WHO in this area. She is also a member of several professional
societies, including the Infectious Diseases Society of America, the American
Society for Microbiology, and the American Society of Virology.

DAVID L. HEYMANN, M.D., is currently the Executive Director of the World

Health Organization (WHO) Communicable Diseases Cluster. From October
1995 to July 1998 he was Director of the WHO Programme on Emerging and
Other Communicable Diseases Surveillance and Control. Prior to becoming di-
rector of this program, he was the chief of research activities in the Global
Programme on AIDS. From 1976 to 1989, prior to joining WHO, Dr Heymann
spent 13 years working as a medical epidemiologist in sub-Saharan Africa
(Cameroon, Ivory Coast, the former Zaire, and Malawi) on assignment from the
Centers for Disease Control and Prevention (CDC) in activities aimed at strength-
ening capacity in surveillance of infectious diseases and their control, with spe-
cial emphasis on the childhood immunizable diseases, African hemorrhagic fe-
vers, pox viruses, and malaria. While based in Africa, Dr. Heymann participated

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

200 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

in the investigation of the first outbreak of Ebola in Yambuku (former Zaire) in

1976, then again investigated the second outbreak of Ebola in 1977 in Tandala,
and in 1995 directed the international response to the Ebola outbreak in Kikwit.
Prior to 1976, Dr. Heymann spent two years in India as a medical officer in the
WHO Smallpox Eradication Programme. Dr. Heymann holds a B.A. from the
Pennsylvania State University, an M.D. from Wake Forest University, and a Di-
ploma in Tropical Medicine and Hygiene from the London School of Hygiene
and Tropical Medicine, and completed practical epidemiology training in the
Epidemic Intelligence Service (EIS) training program of the CDC. He has pub-
lished 131 scientific articles on infectious diseases in peer-reviewed medical and
scientific journals.

JAMES M. HUGHES, M.D., is the Director of the National Center for Infec-
tious Diseases at the Centers for Disease Control and Prevention (CDC) and an
Assistant Surgeon General in the Public Health Service. A board-certified physi-
cian in internal medicine, infectious diseases, and preventive medicine, Dr.
Hughes received his B.A. and M.D. from Stanford University in 1966 and 1971,
respectively. He completed his residency in internal medicine at the University of
Washington and a fellowship in infectious diseases at the University of Virginia.
Since joining CDC in 1973 as an Epidemic Intelligence Service officer, he has
worked primarily on foodborne disease and infection control in health care set-
tings. In 1992, Dr. Hughes became Director of the National Center for Infectious
Diseases, which is addressing domestic and global challenges posed by emerging
infectious diseases and the threat of bioterrorism. He is a member of the Institute
of Medicine and a fellow of the American College of Physicians, the Infectious
Diseases Society of America, and the American Association for the Advance-
ment of Science.

LONNIE KING, D.V.M., is Dean of the College of Veterinary Medicine, Michi-

gan State University. Dr. King’s previous positions include both Associate Ad-
ministrator and Administrator of the USDA Animal and Plant Health Inspection
Service (APHIS) and Deputy Administrator for USDA/APHIS/Veterinary Ser-
vices. Before his government career, Dr. King was in private practice. He also has
experience as a field veterinary medical officer, station epidemiologist, and staff
assignments involving Emergency Programs and Animal Health Information. Dr.
King has also directed the American Veterinary Medical Association’s Office of
Governmental Relations, and is certified in the American College of Veterinary
Preventive Medicine. He has served as President of the Association of American
Veterinary Medicine Colleges, and currently serves as Co-Chair of the National
Commission on Veterinary Economic Issues, Lead Dean at Michigan State Uni-
versity for food safety with responsibility for the National Food Safety and Toxi-
cology Center, the Institute for Environmental Toxicology, and the Center for

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

APPENDIX C 201

Emerging Infectious Diseases. He is also codeveloper and course leader for Sci-
ence, Politics, and Animal Health Policy. Dr. King received his B.S. and D.V.M.
degrees from The Ohio State University, and his M.S. degree in epidemiology
from the University of Minnesota. He has also completed the Senior Executive
Program at Harvard University, and received a M.P.A. from American Univer-
sity. Dr. King previously served on the Committee for Opportunities in Agricul-
ture, the Steering Committee for a Workshop on the Control and Prevention of
Animal Diseases, and the Committee to Ensure Safe Food from Production to
Consumption.

JOSHUA LEDERBERG, Ph.D., is Professor emeritus of Molecular Genetics

and Informatics and Sackler Foundation Scholar at The Rockefeller University in
New York City. His lifelong research, for which he received the Nobel Prize in
1958, has been on the genetic structure and function in microorganisms. Keenly
interested in international health, Dr. Lederberg co-chaired both the Institute of
Medicine Committee on Emerging Microbial Threats to Health (1990–1992) and
its successor, the IOM Committee on Emerging Microbial Threats to Health in
the 21st Century (2001–2003). He has been a member of the National Academy
of Sciences since 1957 and is a charter member of the Institute of Medicine.

JOSEPH MALONE, M.D., is Director of the Department of Defense Global

Emerging Infection System (DoD–GEIS). The author of more than 20 publica-
tions, he is also an Associate Professor at the Uniformed Services University of
Health Sciences and holds the Certificate of Knowledge in Travelers’ Health and
Tropical Medicine from the American Society of Tropical Medicine and Hygiene.
CAPT Malone has won several military awards, including the Crisis Response
Service Award from the Department of Health and Human Services’ U.S. Public
Health Service. Dr. Malone graduated from Boston University School of Medi-
cine in 1980. He trained in internal medicine and infectious diseases at the Naval
Hospitals in San Diego and in Bethesda, MD, leading to board certification, and
became a staff physician at both hospitals. His naval career has included deploy-
ment to Guantanamo Bay, Cuba, in support of Operation Safe Harbor; attachment
to Surgical Team 1 during Operation Desert Shield; and directorship of the Infec-
tious Disease Division and HIV unit at the Naval Medical Center at Portsmouth,
VA. His affiliation with DoD–GEIS began in 1999 while working with the Dis-
ease Surveillance Program at U.S. Naval Medical Research Unit No. 3 in Cairo,
Egypt. Later, as a member of the Centers for Disease Control and Prevention’s
(CDC) Epidemic Intelligence Service (EIS) program, Dr. Malone was deployed
to New York City to aid the emergency public health response to the attacks of
September 11, 2001. He also assisted in the public health response to documented
anthrax contamination in Kansas City and was the acting state epidemiologist for
the State of Missouri from February through June 2003, when he completed the
CDC EIS program.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

202 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

LYNN MARKS, M.D., is Senior Vice President of Infectious Diseases in the

Medicine Development Center of GlaxoSmithKline. A board-certified physician
in internal medicine and infectious diseases, he previously was on faculty of the
Infectious Diseases department of the University of South Alabama College of
Medicine. There he focused on patient care, teaching, and research on the mo-
lecular genetics of bacterial pathogenicity. He subsequently joined the anti-
infectives clinical group of SmithKline Beecham, now GlaxoSmithKline, and
progressed to become the global head of the Consumer Healthcare division’s
Medical and Regulatory group. The move to his present position represented a
return to pharmaceutical research and development.

STEPHEN S. MORSE, Ph.D., is Director of the Center for Public Health Pre-
paredness at the Mailman School of Public Health of Columbia University, and a
faculty member in the Epidemiology Department. Dr. Morse recently returned to
Columbia after four years in government service as Program Manager at the De-
fense Advanced Research Projects Agency, where he co-directed the Pathogen
Countermeasures program and subsequently directed the Advanced Diagnostics
program. Before coming to Columbia, he was Assistant Professor of Virology at
The Rockefeller University in New York, where he remains an adjunct faculty
member. Dr. Morse is the editor of two books, Emerging Viruses (Oxford Uni-
versity Press, 1993; paperback, 1996) and The Evolutionary Biology of Viruses
(Raven Press, 1994); the former was selected by American Scientist as one of the
“100 Top Science Books of the 20th Century.” Dr. Morse serves as a Section
Editor of the CDC journal Emerging Infectious Diseases and was formerly an
Editor-in-Chief of the Pasteur Institute’s journal Research in Virology. As the
chair and principal organizer of the 1989 Conference on Emerging Viruses held
by the National Institute for Allergy and Infectious Disease, National Institutes of
Health, he coined the term and concept of emerging viruses and infections. He
was a member of the joint Institute of Medicine (IOM)–National Academy of
Sciences’ Committee on Emerging Microbial Threats to Health, chaired its task
force on viruses, and contributed the committee’s report, Emerging Infections
(1992). He also was a member of the IOM Committee on Xenograft Transplanta-
tion. Dr. Morse has been an adviser to the World Health Organization, the Pan-
American Health Organization, the U.S. Food and Drug Administration, the De-
fense Threat Reduction Agency, and other federal agencies. He is a Fellow of the
New York Academy of Sciences and a past Chair of its Microbiology Section. He
was the founding Chair of ProMED, the nonprofit international Program to Moni-
tor Emerging Diseases, and was an originator of ProMED-mail, an international
network inaugurated by ProMED in 1994 for outbreak reporting and disease
monitoring using the Internet. At present, he serves on the Steering Committee of
the Institute of Medicine’s Forum on Microbial Threats. Dr. Morse received his
Ph.D. from the University of Wisconsin–Madison.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

APPENDIX C 203

MICHAEL T. OSTERHOLM, Ph.D., M.P.H., is Director of the Center for

Infectious Disease Research and Policy at the University of Minnesota where he
is also Professor at the School of Public Health. Previously, Dr. Osterholm was
the state epidemiologist and Chief of the Acute Disease Epidemiology Section
for the Minnesota Department of Health. He has received numerous research
awards from the National Institute of Allergy and Infectious Diseases and the
Centers for Disease Control and Prevention (CDC). He served as principal inves-
tigator for the CDC-sponsored Emerging Infections Program in Minnesota. He
has published more than 240 articles and abstracts on various emerging infectious
disease problems and is the author of the best selling book, Living Terrors: What
America Needs to Know to Survive the Coming Bioterrorist Catastrophe. He is
past president of the Council of State and Territorial Epidemiologists. He has
served on the Institute of Medicine’s Committee on Food Safety, Production to
Consumption and Committee on the Department of Defense Persian Gulf Syn-
drome Comprehensive Clinical Evaluation Program. In addition, he was a re-
viewer of the Institute of Medicine’s report on chemical and biological terrorism.

GEORGE POSTE, Ph.D., D.V.M., is Director of the Arizona Biodesign Insti-

tute and Dell E. Webb Distinguished Professor of Biology at Arizona State Uni-
versity. From 1992 to 1999, he was Chief Science and Technology Officer and
President, Research and Development of SmithKline Beecham. During his tenure
there, he was associated with the successful registration of 29 drug, vaccine and
diagnostic products. He is Chairman of diaDexus and Structural GenomiX in
California and Orchid Biosciences in Princeton. He serves on the Board of Direc-
tors of AdvancePCS and Monsanto. He is an advisor on biotechnology to several
venture capital funds and investment banks. In May 2003, he was appointed as
Director of the Arizona Biodesign Institute at Arizona State University. This is a
major new initiative combining research groups in biotechnology,
nanotechnology, materials science, advanced computing and neuromorphic engi-
neering. He is a Fellow of Pembroke College Cambridge and Distinguished Fel-
low at the Hoover Institution and Stanford University. He is a member of the
Defense Science Board of the U.S. Department of Defense and in this capacity he
chairs the Task Force on Bioterrorism. He is also a member of the National
Academy of Sciences Working Group on Defense Against Bioweapons. Dr. Poste
is a Board Certified Pathologist, a Fellow of the Royal Society and a Fellow of
the Academy of Medical Sciences. He was awarded the rank of Commander of
the British Empire by Queen Elizabeth II in 1999 for services to medicine and for
the advancement of biotechnology. He has published more than 350 scientific
papers, coedited 15 books on cancer, biotechnology and infectious diseases and
serves on the Editorial Board of multiple technical journals. He is invited rou-
tinely to be the keynote speaker at a wide variety of academic, corporate, invest-
ment and government meetings to discuss the impact of biotechnology and genet-
ics on healthcare and the challenges posed by bioterrorism. Dr. Poste is married

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

204 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

with three children. His personal interests are in military history, photography,
automobile racing and exploring the wilderness of the American West.

GARY A. ROSELLE, M.D., received his M.D. from Ohio State University
School of Medicine in 1973. He served his residency at Northwestern University
School of Medicine and his Infectious Diseases fellowship at the University of
Cincinnati School of Medicine. Dr. Roselle is the Program Director for Infectious
Diseases for the Department of Veterans Affairs Central Office in Washington,
D.C., as well as the Chief of the Medical Service at the Cincinnati Veterans Affairs
Medical Center. He is a professor of medicine in the Department of Internal Medi-
cine, Division of Infectious Diseases at the University of Cincinnati College of
Medicine. Dr. Roselle serves on several national advisory committees. In addi-
tion, he is currently heading the Emerging Pathogens Initiative for the Depart-
ment of Veterans Affairs. Dr. Roselle has received commendations from the
Cincinnati Medical Center Director, the Under Secretary for Health for the
Department of Veterans Affairs, and the Secretary of Veterans Affairs for his
work in the infectious diseases program for the Department of Veterans Affairs.
He has been an invited speaker at several national and international meetings, and
has published more than 80 papers and several book chapters.

JANET SHOEMAKER, is director of the American Society for Microbiology’s

Public Affairs Office, a position she has held since 1989. She is responsible for
managing the legislative and regulatory affairs of this 42,000-member organiza-
tion, the largest single biological science society in the world. She has served as
principal investigator for a project funded by the National Science Foundation
(NSF) to collect and disseminate data on the job market for recent doctorates in
microbiology and has played a key role in American Society for Microbiology
(ASM) projects, including the production of Employment Outlook in the Micro-
biological Sciences and The Impact of Managed Care and Health System Change
on Clinical Microbiology. Previously, she held positions as Assistant Director of
Public Affairs for ASM, as ASM coordinator of the U.S.–U.S.S.R. Exchange
Program in Microbiology (a program sponsored and coordinated by the National
Science Foundation and the U.S. Department of State), and as a freelance editor
and writer. She received her baccalaureate cum laude from the University of
Massachusetts and is a graduate of the George Washington University programs
in public policy and in editing and publications. She has served as commissioner
to the Commission on Professionals in Science and Technology, and as the ASM
representative to the ad hoc Group for Medical Research Funding, and is a mem-
ber of Women in Government Relations, the American Society of Association
Executives, and the American Association for the Advancement of Science. She
has coauthored published articles on research funding, biotechnology, biological
weapons control, and public policy issues related to microbiology.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

APPENDIX C 205

P. FREDERICK SPARLING, M.D., is the J. Herbert Bate Professor emeritus

of Medicine, Microbiology and Immunology at the University of North Carolina
(UNC) at Chapel Hill, and is Director of the North Carolina Sexually Transmitted
Infections Research Center. Previously, he served as chair of the Department of
Medicine and chair of the Department of Microbiology and Immunology at UNC.
He was president of the Infectious Disease Society of America in 1996–1997. He
was also a member of the Institute of Medicine’s Committee on Microbial Threats
to Health (1991–1992). Dr. Sparling’s laboratory research is in the molecular
biology of bacterial outer membrane proteins involved in pathogenesis, with a
major emphasis on gonococci and meningococci. His current studies focus on the
biochemistry and genetics of iron-scavenging mechanisms used by gonococci
and meningococci and the structure and function of the gonococcal porin pro-
teins. He is pursuing the goal of a vaccine for gonorrhea.

SPEAKERS
KATHRYN M. CARBONE, M.D., is the Acting Associate Director for Re-
search at FDA’s Center for Biologics Evaluation and Research (CBER) and leads
Virus Vaccine Neurovirulence Test Development in CBER’s Laboratory of Pedi-
atric and Respiratory Viral Diseases. She is also an Associate Profesor at Johns
Hopkins University School of Medicine and an Adjunct Professor of Medicine at
George Washington University. Dr. Carbone graduated magna cum laude from
Harvard–Radcliffe College in 1979 and graduated with honors from the Univer-
sity of Wisconsin School of Medicine in 1983. She completed internal medicine
and subspecialty training in infectious diseases at Johns Hopkins Hospital, re-
ceiving her board certifications in 1986 and 1988. Upon joining the faculty of the
Johns Hopkins School of Medicine in 1988, she continued studying virus infec-
tions of the brain with a special focus on multidisciplinary studies of the develop-
ing rat nervous system with Borna disease virus. She has continued these studies
and also has investigated the neurovirulence of vaccines for viral diseases such as
mumps since joining CBER in 1996 as Chief of the Laboratory of Pediatric and
Respiratory Viral Diseases.

MICHAEL DUNNE, M.D., is Vice President of Clinical Development for In-

fectious Diseases at Pfizer Global Research and Development Headquarters lo-
cated in New London, Connecticut. He received his M.D. from the State Univer-
sity of New York in Brooklyn, and completed his internal medicine training as
well as fellowships in pulmonary medicine and infectious diseases at Yale New
Haven Hospital. Dr. Dunne joined Pfizer in 1992. His focus in industry has in-
cluded the development of antibiotics for treatment of diseases of the respiratory
tract, opportunistic infections in HIV infected patients and malaria. He has also
been involved in the development of antibiotics for the treatment of coronary
artery disease.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

206 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

MAUREEN DURKIN, Ph.D., Dr.P.H., is Associate Professor of Public Health

(Epidemiology) at Columbia University’s Mailman School of Public Health and
Sergievsky Center, and Research Scientist at the New York State Psychiatric
Institute’s Epidemiology of Brain Disorders Unit. Dr. Durkin has developed meth-
odology for and directed comparative studies of the prevalence and causes of
neurodevelopmental disabilities in developing countries. Her current research
pertains to international policies relevant to public health and developmental dis-
abilities, the epidemiology and prevention of pediatric neurotrauma, and long-
term outcomes of premature birth. She has published widely on these topics,
presented at national and international scientific meetings, and taught graduate
level courses. Dr. Durkin has served as an advisor to the World Health Organiza-
tion and a consultant to numerous organizations including the United Nations
Statistical Office and the National Institutes of Health.

EDUARDO L. FRANCO, M.P.H., Dr.P.H., is Professor of Epidemiology and

Oncology and Director, Division of Cancer Epidemiology at McGill University’s
Faculty of Medicine in Montreal, Canada. He was formerly a faculty member at
Université du Québec (1989–1994) and Senior Researcher and Head of Epidemi-
ology at the Ludwig Institute for Cancer Research, Sao Paulo, Brazil (1985–
1989). He received his undergraduate degree in biology (1975) from Universidade
de Campinas, Brazil, and received graduate training in public health microbiol-
ogy at the University of North Carolina at Chapel Hill (1981–1984). A Guest
Researcher at the Centers for Disease Control in Atlanta from 1980 to 1981 and
1983 to 1984, Dr. Franco received postdoctoral training in cancer epidemiology
at the International Agency for Research on Cancer in Lyon, France; at the Na-
tional Cancer Institute (NCI) in Bethesda, MD; and at Louisiana State University.
During the past 15 years, he has studied the molecular epidemiology and preven-
tion of cervical cancer, upper aerodigestive tract cancers and childhood tumors,
and the development of epidemiologic methods in the evaluation of screening
efficacy and assessment of misclassification. He has published more than 170
scientific articles and chapters and edited two books on cancer epidemiology and
prevention. Dr. Franco has held Associate Editor assignments with the American
Journal of Epidemiology (1993–98) and with Cancer Epidemiology, Biomarkers
& Prevention (since 1995), and as Editorial Board Member for Epidemiology,
Medical and Pediatric Oncology, Cancer Detection and Prevention, and Cancer
Prevention & Control. He has served on scientific and grant review panels at the
National Cancer Institute, NIH; the Medical Research Council of Canada (MRC);
the National Cancer Institute of Canada; the Pan American Health Organization;
Health Canada; Fonds de la recherche en santé du Québec (FRSQ); and the UK
Cancer Research Campaign. He has mentored more than 50 graduate students
and postdoctoral fellows since 1985. In addition to teaching at McGill, he has
been an instructor in several annual or sporadic cancer epidemiology courses in
the United States, South America, Europe, and the Middle East. He has served as

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

APPENDIX C 207

a member or chair of organizing or program committees for 12 international con-

ferences on cancer epidemiology, papillomavirus research, and oncology. Dr.
Franco has received numerous awards, including MRC Distinguished Scientist
(2000), Educational Excellence at McGill University (2000), City of Montreal’s
“Ambassadeur” (2000), FRSQ’s National Research Scholar Award (1999).

EDUARDO GOTUZZO, M.D., is Principal Professor and Director at the

Instituto de Medicina Tropical “Alexander von Humbolt,” Universidad Peruana
Cayetan Heredia (UPCH), in Lima, Peru. He is also Chief of the Department of
Infectious and Tropical Diseases at the Cayetano Heredia Hospital and an Ad-
junct Professor of Medicine at the University of Alabama–Birmingham School of
Medicine. Dr. Gotuzzo has been an active member of numerous international
societies such as the Latin America Society of Tropical Disease (President, 2000–
2003), the Scientific Program of Infectious Diseases Society of America (2000–
2003), the International Organizing Committee of the International Congress of
Infectious Diseases (1994–present), the International Society for Infectious Dis-
eases (President Elect, 1996–1998), and the Peruvian Society of Internal Medi-
cine (President, 1991–1992). He has published more than 230 articles and chap-
ters as well as 6 manuals and 1 book. Among the many recent honors and awards
he has received, he was named an Honorary member of American Society of
Tropical Medicine and Hygiene (2002), an Associated Member of National Acad-
emy of Medicine (2002), an Honorary Member of Society of Internal Medicine
(2000), a Distinguished Visitor, Faculty of Medical Sciences, University of
Cordoba, Argentina (1999), and the receipient of the Golden Medal for Outstand-
ing Contribution in the field of Infectious Diseases from Trnava University,
Slovakia (1998).

RICHARD L. GUERRANT, M.D., is Thomas H. Hunter Professor of Interna-

tional Medicine and Director of the Office of International Health at the Univer-
sity of Virginia School of Medicine. Author of more than 350 scientific articles
and reviews and numerous major textbook chapters, and editor of 6 books, Dr.
Guerrant graduated from Davidson College and University of Virginia School of
Medicine and was trained in internal medicine and infectious diseases at the
Harvard Medical Service of the Boston City Hospital, NIH, Johns Hopkins and
UVa. He has worked in the Congo, Bangladesh, and Brazil and started the Divi-
sion of Geographic and International Medicine with Kellogg and Rockefeller sup-
port in 1978. Since then he has recruited outstanding faculty (including Drs. Ri-
chard Pearson, Erik Hewlett, Jonathan Ravdin, Cynthia Sears, David Bobak, and
Nathan Thielman) and his group has trained more than 90 postdoctoral fellows
and students who are becoming leaders in tropical medicine, including Dr. James
Hughes, Director of NCID at CDC, Drs. Jonathan Ravdin, Cynthia Sears, Chris
Wanke and Aldo Lima. Dr. Guerrant is holder of 8 patents on innovative ap-
proaches to the diagnosis and treatment of common gastrointestinal illnesses and

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

208 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

was Henderson Inventor of the Year in 1997 for his new glutamine derivative-
based ORNT (oral rehydration and nutrition therapy). Guerrant was named Pro-
fessor Honoris Causa at UFC and received the Emilio Ribas Medal of the Brazil-
ian Society of Infectious Diseases in 1997. He has served on several editorial and
USDA and WHO advisory boards, VA and NIH Study Sections, Clark and Child
Health Foundation Boards, chaired the U.S. Cholera Panel of the U.S.–Japan
Cooperative Medical Science Program, and the International Affairs Committee
of the Infectious Diseases Society of America.

RICHARD T. JOHNSON, M.D., is Distinguished Service Professor of Neurol-

ogy, Microbiology and Neuroscience at the Johns Hopkins University School of
Medicine. He has a joint appointment in the Department of Molecular Microbiol-
ogy and Immunology at the Johns Hopkins University Bloomberg School of Pub-
lic Health. He has studied the pathogenesis of viral infections of the nervous
system in animals and humans including studies of acute meningitis and encepha-
litis, viral-induced malformations, demyelinating diseases, and HIV-associated
neurological diseases. He has published more than 300 articles and chapters and
10 books including a single authored volume on Viral Infections of the Nervous
System (2nd ed. 1998). He was Director of the Department of Neurology at Johns
Hopkins between 1988 and 1997. Since retiring from that post, he has been the
Editor of Annals of Neurology, served for 3 years as Founding Director of the
National Neuroscience Institute of Singapore, chaired the Institute of Medicine
Committee on Transmisssible Spongiform Encephalopathies: Assessment of Rel-
evant Science, and is a Special Consultant to the National Institutes of Health on
Transmissible Spongiform Encephalopathies. Dr. Johnson has been a member of
the Institute of Medicine since 1987.

ALTAF LAL, Ph.D., is the Chief of Molecular Vaccine Section, Division of

Parasitic Diseases, National Center for Infectious Diseases, CDC. He is also an
adjunct Professor in the Biology Department, Emory University. Dr. Lal received
his PhD in Chemistry from Kanpur University and did his work at the Central
Drug Research Institute, Lucknow. He was a Fogarty Visiting Fellow at the Na-
tional Heart Lung and Blood Institute (NHLBI) and National Institute of Allergy
and Infectious Diseases (NIAID). He has been at CDC for the last 12 years; his
research program focuses on conducting laboratory and field studies on parasitic
diseases, with a focus on malaria. In addition to conducting studies in Atlanta-
based laboratories, Dr. Lal conducts field-based studies on malaria in western
Kenya and enteric parasite work in Calcutta, India. He also collaborates with
investigators working on malaria in several South American, Asian, and African
countries. He has published more than 175 articles and has received funding from
the U.S. Agency for International Development, WHO, NIH, the National Vac-
cine Program Office at CDC, and the U.S. Environmental Protection Agency.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

APPENDIX C 209

W. IAN LIPKIN, M.D., is Professor of Epidemiology at the Mailman School of

Public Health, Director of the Laboratory for Immunopathogenesis and Infec-
tious Diseases and Center for Developmental Neuroscience of Columbia Univer-
sity, and the Louise Turner Arnold Chair of Neurosciences and Professor of Neu-
rology, Anatomy and Neurobiology, and Microbiology and Molecular Genetics
at the University of California, Irvine. Dr. Lipkin was the first to identify an
infectious agent by subtractive cloning (Borna disease virus, 1990). He also led
the team that used unique molecular methods to identify the West Nile virus as
the cause of the encephalitis outbreak in New York State in the fall of 1999. His
laboratory investigates the role of infectious agents and immune responses in
pathogenesis of acute and chronic central nervous system diseases through mo-
lecular epidemiology and animal modeling. Dr. Lipkin received a BA from Sarah
Lawrence College in 1974, and an MD from Rush Medical College in 1978. His
postgraduate training included Residency in Internal Medicine at the University
of Washington in 1979–81, Residency in Neurology at the University of Califor-
nia, San Francisco in 1981–84, and Fellowship in Neurovirology and Molecular
Neurobiology at The Scripps Research Institute from 1984–1990. He is a 1991
Pew Scholar and a 2001 Ellison Medical Foundation Senior Scholar in Global
Infectious Disease.

WILLIAM MASON, Ph.D., Senior Member at the Fox Chase Cancer Center,
joined in 1973 following a postdoctoral fellowship in retrovirology in the labora-
tory of Dr. Peter K. Vogt, at the University of Southern California. He began
working on hepatitis B in 1980 following the discovery of duck hepatitis B virus
by Dr. Jesse Summers. This early work, carried out in collaboration with Sum-
mers and with John Taylor, led to the widespread adoption of this animal model
as the system for studying how these viruses replicate. One of the immediate
consequences of this work was the discovery by Summers and Mason that hepa-
titis B viruses replicate by reverse transcription, like the retroviruses, and the
development of a detailed model for this process, again with Summers and Tay-
lor. The duck virus also served as an early and continuing model for the evalua-
tion of antiviral therapies. Since 1990, Dr. Mason’s lab has studied how hepatitis
B viruses maintain a chronic infection, and the effects of antiviral agents such as
lamivudine and L-FMAU on this process. This work has employed the duck
model of chronic infection, as well as the woodchuck model, which had been
discovered by Summers in the 1970s. Current work in Mason’s laboratory is
focused on the consequences of combining drug therapy with immunotherapy to
stimulate the host’s defenses against infected liver cells, and microarray technol-
ogy to evaluate the progression of chronic infections.

PATRICK S. MOORE, M.D., M.P.H., is Professor and Codirector, KSHV

Laboratory, Department of Pathology at Columbia University. Dr. Moore’s pri-
mary research interest involves use of molecular biology to investigate funda-

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

210 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

mental epidemiologic problems. His laboratory is devoted to discovery and char-

acterization of new viruses associated with chronic diseases. In collaboration with
his wife and lab codirector, Dr. Yuan Chang, he discovered the newest human
tumor virus, Kaposi’s sarcoma-associated herpesvirus (KSHV) in 1993. Subse-
quent work from this laboratory demonstrated the causal association between
KSHV and KS using a modern reinterpretation of Hill’s criteria and employing
whole KSHV genome sequencing and development of serologic and DNA-based
assays. Current research efforts are devoted to identifying specific KSHV genes
causing cell transformation and proliferation. Dr. Moore received his MD from
the University of Utah (1985) and an MPH from University of California,
Berkeley (1989). He was an Epidemic Intelligence Service (EIS) Officer in the
Meningitis and Special Pathogens Branch, CDC (1987–1989), and was involved
in the discovery and characterization of the 1988–1996 clone III-1 group A N.
meningitidis pandemic of sub-Saharan Africa. He also led refugee evaluation
teams in Nepal and Somalia in 1992 for CDC and was the New York City Epide-
miologist in 1993.

DAVID M. MORENS, M.D., received the A.B. degree (Psychology) in 1969

and the M.D. degree in 1973, both from the University of Michigan. He is Board
Certified in Pediatrics (1978) and in Preventive Medicine (1980), with fellowship
training in pediatric infectious diseases. He was also trained in epidemiology in
the Epidemic Intelligence Service of the U.S. Centers for Disease Control and
Prevention (CDC). After joining the CDC staff, Dr. Morens served as a medical
virologist studying enteroviruses and enteric gastroenteritis viruses, as Chief of
CDC’s Respiratory & Special Pathogens Branch, and for two years studied Lassa
fever in Sierra Leone, West Africa. From 1982 to 1998, he was Professor of
Tropical Medicine at the University of Hawaii, and from 1987–1998 Professor
and Chairman, Epidemiology Department, School of Public Health. Dr. Morens’
has studied the epidemiology of viral hemorrhagic fevers, viral pathogenesis, and
the integration and role of epidemiology in biomedical science and research. His
career interest for more than 25 years has been on emerging infectious diseases
and on diseases of unknown etiology. In the past decade he has published and
spoken on numerous aspects of the history of epidemiology and infectious dis-
eases. Currently Dr. Morens is on University leave, working in the National Insti-
tute of Allergy and Infectious Diseases of NIH.

SIOBHÁN O’CONNOR, M.D., M.P.H., is the Assistant to the Director of the

National Center for Infectious Diseases, CDC, for Infectious Causes of Chronic
Diseases, and a Clinical Assistant Professor of Medicine at Emory University
School of Medicine. She received a Master of Public Health from the Harvard
School of Public Health in 1997, her Doctor of Medicine from the University of
Texas Health Science Center at Houston in 1986, and a Bachelor of Science from
the Georgia Institute of Technology. Her postdoctoral training includes both clini-

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

APPENDIX C 211

cal rheumatology and laboratory research fellowships at Washington University

in St. Louis School of Medicine/Barnes Hospital following a residency in internal
medicine at the University of Texas Health Science Center at Houston. She has
been board certified in internal medicine and rheumatology. Dr. O’Connor joined
the CDC in 1997 to develop a collaborative research agenda on infectious etiolo-
gies of chronic diseases. Activities emphasize integrating laboratory science, epi-
demiology and surveillance to define causal links between recognized and novel
infectious agents and chronic syndromes, translating findings into prevention
strategies for the populations at risk. In this capacity, Dr. O’Connor also serves
on the NIH Autoimmune Diseases Coordinating Committee, chairs several
multidisciplinary and multi-agency committees on related issues and serves as a
national advisor to a clinical consortium. She is a member of the Infectious Dis-
eases Society of America, the American College of Rheumatology, and the
American Society for Microbiology.

MARK A. PALLANSCH, Ph.D., is a Distinguished Consultant and Chief of the

Enterovirus Section in the Respiratory and Enteric Viruses Branch at the Centers
for Disease Control and Prevention, Atlanta, Georgia. Responsibilities include
multiple areas of research and testing with poliovirus and the non-polio enterovi-
ruses. Research areas include studies of natural variation and recombination,
molecular epidemiology, and association of enterovirus infection with neonatal
infections and chronic diseases such as juvenile-onset diabetes and myocarditis.
Also responsible for enterovirus diagnostics, which includes laboratory support
for epidemiological studies, characterization of enterovirus isolates, identifica-
tion and strain characterization of poliovirus isolates, and development of im-
proved diagnostic techniques and reagents. Directly involved in supporting de-
sign, technology and implementation of the poliovirus laboratory network as part
of the global poliovirus eradication initiative.

DAVID PERSING, M.D., Ph.D., is Vice President of Discovery Research at

Corixa Corporation, and Medical Director of the Infectious Disease Research
Institute, both located in Seattle, WA. David earned his M.D.–Ph.D. from Uni-
versity of California, San Francisco (UCSF) in 1988. The research for his doc-
toral thesis in biochemistry and biophysics was conducted in the laboratories of
Don Ganem and Harold Varmus at UCSF. After completing his residency in
Laboratory Medicine at the Yale University School of Medicine, he joined the
staff of the Mayo Clinic, where he established research programs in tickborne
diseases, hepatitis viruses, and infections associated with human cancer. In 1992
he became founding director of the Clinic’s Molecular Microbiology Laboratory,
which became one of the preeminent molecular diagnostic laboratories of its type
in the United States. In 1999, he assumed his present position in Seattle, where
his focus is on innate immunity, vaccine development, and human immunoge-
netic influences on vaccine responses. He is principal investigator of a $3.5 mil-

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

212 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

lion, two year research program on innate immunity funded by the Defense Ad-
vanced Research Projects Agency (DARPA), and has a long track record of ex-
tramural funding from the National Institutes of Health. David serves on a num-
ber of corporate boards and advisory councils including the Boards of Directors
for Virologic and ASM resources, and science advisory boards for IDI, the Burrill
and Company Life Sciences Investment Funds, and the Mayo Clinic Clinical
Research Center. He has authored 213 peer-reviewed articles and book chapters,
has served as Editor-in-Chief of 2 books, and is listed as an inventor on 21 issued
or pending U.S. patents.

MIKHAIL PLETNIKOV, M.D., Ph.D., is Assistant Professor of Department

of Psychiatry and Behavioral Sciences, The Johns Hopkins School of Medicine,
Baltimore, MD. He graduated with Honors from I.M. Sechenov Moscow Medical
Institute, Moscow, Russia in 1986. He completed his postgraduate training in
normal physiology at PK Anokhin Institute of Normal Physiology, Moscow, Rus-
sia in 1989 and received his Ph.D. in normal physiology in 1990. He joined the
laboratory of molecular neurophysiology of that institute the same year and
worked there until 1996 as a team leader with a special interest in a
neurobehavioral analysis of a role of the cerebellum and hippocampus in learning
and memory in developing and adult rats. From 1996 to 1999, he was a
postdoctoral fellow at the laboratory of Dr. Kathryn Carbone at CBER/FDA and
Johns Hopkins University School of Medicine studying neurobehavioral conse-
quences of neonatal Borna disease virus infection. He joined the faculty of the
Johns Hopkins University School of Medicine in 1999 and continues pathogen-
esis studies of neurodevelopmental damage using the neonatal Borna disease vi-
rus infection animal model.

THOMAS C. QUINN, M.D., M.Sc., is Senior Investigator and Head of the Sec-
tion on International AIDS Research in the Laboratory of Immunoregulation at
the National Institute of Allergy and Infectious Diseases. Since 1981, he has been
assigned to the Division of Infectious Diseases at Johns Hopkins University
School of Medicine where he is a Professor of Medicine. He also has adjunct
appointments in the Department of International Health, and the Department of
Immunology and Molecular Microbiology in The Johns Hopkins School of Hy-
giene and Public Health. He currently directs the Johns Hopkins School of Medi-
cine P3 HIV/AIDS Research Facility and the International STD Research Labo-
ratory. Dr. Quinn’s investigations have involved the study of the epidemiologic,
virologic, immunologic features of HIV infection in Africa, the Caribbean, South
America and Asia. In 1984, he helped establish the interagency project called
“Project SIDA” in Kinshasa, Zaire which was the largest AIDS investigative
project in sub-Saharan Africa. Dr. Quinn has been involved in laboratory investi-
gations which have helped define the biological factors involved in heterosexual
transmission and perinatal transmission, the natural history of HIV infections in

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

APPENDIX C 213

developing countries, and the identification and characterization of unique strains

of HIV-1 infection. Immunologic studies have included the changes in T-cell
phenotypes and cytokines in patients with HIV infection and other endemic tropi-
cal diseases such as malaria and tuberculosis. Among his professional activities,
Dr. Quinn has been an Advisor/Consultant on HIV and STDs to the World Health
Organization, UNAIDS and the U.S. Food and Drug Administration. He is a
member of Editorial Boards of six journals focusing on infectious diseases, AIDS
and sexually transmitted diseases. He is an author of more than 600 publications
on HIV, STDs and infectious diseases.

JOSEMIR W. SANDER, M.D., M.R.C.P., Ph.D., is the NSE Professor of Neu-

rology and Clinical Epilepsy at the Institute of Neurology of University College,
London. He is Honorary Consultant Neurologist at the National Hospital for Neu-
rology and Neurosurgery in London, Queen Square and at the National Society
for Epilepsy in Buckinghamshire. Dr. Sander is Head of the WHO Collaborative
Centre for Research and Training in Neurosciences, London, and Director of the
Clinical Trials Unit at the National Society for Epilepsy–Chalfont Centre. He
qualified in the University of Parana in Brazil and after his initial medical train-
ing in Brazil, he moved to the United Kingdom where he completed his neuro-
logical training. He obtained his Ph.D. at the Faculty of Medicine of the Univer-
sity of London. He serves as a member of the Management Committee of the
International League Against Epilepsy and is a member of numerous organisations
and professional societies including the Royal Society of Medicine, The Ameri-
can Academy of Neurology, The American Epilepsy Society and the British
Medical Association. A frequent speaker at international conferences and a mem-
ber of the editorial boards of several specialist journals, Dr. Sander has published
extensively on various aspects of epilepsy, particularly drug issues, patient care
and epidemiology. The International League against Epilepsy and the Interna-
tional Bureau for Epilepsy made him an Ambassador for Epilepsy in 1993.

THOMAS M. SHINNICK, Ph.D., is Chief of the Tuberculosis/

Mycobacteriology Branch of the Division of AIDS, STD, and TB Laboratory
Research at the National Center for Infectious Disease (NCID) at the U.S. Cen-
ters for Disease Control and Prevention (CDC). He also is an Adjunct Professor
in the Department of Microbiology and Immunology at Emory University. The
author or coauthor of more than 130 publications and editor of one book, Dr.
Shinnick has focused his research on understanding the biology and genetics of
the pathogenic mycobacteria, elucidating mechanisms of pathogenicity and drug
resistance of Mycobacterium tuberculosis, and developing rapid methods for the
diagnosis of mycobacterial infections. He received his bachelor of science in bio-
chemistry from the University of Wisconsin–Madison and his doctorate in bio-
chemistry from the Massachusetts Institute of Technology. He won the Johnson
and Johnson Predoctoral Fellowship in 1977 and the Helen Hay Whitney Foun-

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

214 THE INFECTIOUS ETIOLOGY OF CHRONIC DISEASES

dation Postdoctoral Fellowship in 1978, conducting his postdoctoral training at

the Research Institute of Scripps Clinic. Subsequently, he became an assistant
professor in the institute’s department of molecular biology. Dr. Shinnick joined
NCID in 1986 as Chief of the Hansen Disease Laboratory in the Division of
Bacterial and Mycotic Diseases until 1995, when he became Chief of the Immu-
nology and Molecular Pathogensis Section in NCID’s Division of AIDS, STD,
and TB Laboratory Research. The following year, he assumed his current post.
Dr. Shinnick has been honored with the Arthur S. Flemming Award (1990), the
PHS Special Recognition Group Award (1993), and the NCID Honor Award
(1993). He has been a Fellow of the American Academy of Microbiology since
1994 and a member of the Senior Biomedical Research Service since 1997.

SUSAN E. SWEDO, M.D., is Chief of the Pediatrics and Developmental Neu-

ropsychiatry Branch at the National Institute of Mental Health (NIMH), NIH.
There she leads a clinical research team investigating the causes and treatment of
pediatric and neuropsychiatric disorders such as childhood-onset anxiety disor-
ders, affective disorders, and movement disorders such as Tourette’s Syndrome.
Dr. Swedo led the NIMH team that first identified a new subtype of obsessive-
compulsive disorder in children, pediatric autoimmune neuropsychiatric disor-
ders associated with strep. Not only has this work resulted in several new and
prevention strategies, but it has also led to a patent on a biological marker to help
identify children at risk of obsessive-compulsive disorder (OCD) and tic disor-
ders. Dr. Swedo received her M.D. from Southern Illinois University School of
Medicine and served her residency at Children’s Memorial Hospital at North-
western University in Chicago. Dr. Swedo began her career as a practicing pedia-
trician in Chicago, where she served as Chief of Adolescent Medicine at the
McGaw Medical Center of Northwestern University. She moved to the Washing-
ton area in 1986 and joined the staff of the Child Psychiatry Branch at the Na-
tional Institute of Mental Health, where she conducted research on the pharmaco-
logical treatment of childhood OCD. The recipient of numerous awards, including
the American Academy of Child and Adolescent Psychiatry Award for Scientific
Achievement, Dr. Swedo is the author of more than 90 professional books and
articles. She is the co-author with Dr. Henrietta Leonard of It’s Not All in Your
Head for women and Is It Just a Phase?, a parent’s guide to common childhood
behavioral problems.

ROBERT YOLKEN, M.D., graduated from Harvard College and Harvard Medi-
cal School and did a residence in Pediatrics at Yale. He received Fellowship
training at Cornell–New York Hospital and at the Laboratory of Infectious Dis-
eases at the National Institutes of Health. He joined the faculty in the Department
of Pediatrics in 1979 and is currently the Ted and Vada Stanley Distinguished
Professor of Developmental Neurovirology in that Department. His research in-
terests include diagnostic virology and the identification of infectious causes of

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

APPENDIX C 215

chronic diseases. Since 1995 he has worked extensively on studies related to the
etiology of human neuropsychiatric diseases such as schizophrenia and bipolar
disorder. He is the author or coauthor of more than 200 publications in peer re-
viewed journals and is one of the coeditors of the Manual of Clinical Microbiol-
ogy. He has received numerous awards including the Abbott Award for the Rapid
Diagnosis of Human Diseases, the Wellcome Diagnostics Award, and the Mead
Johnson Award for Pediatric Research.

FORUM STAFF
STACEY L. KNOBLER, is Director of the Forum on Microbial Threats at the
Institute of Medicine (IOM). She previously served as the codirector of the IOM
Board on Global Health’s study, Neurological, Psychiatric, and Developmental
Disorders in Developing Countries (2001), and as the research associate for the
Assessment of Future Scientific Needs for Live Variola Virus (1999). Ms. Knobler
is actively involved in program research and development for the Board on Global
Health. Previously, she held positions as a Research Associate at the Brookings
Institution’s Foreign Policy Studies Program and as an Arms Control and
Democratization Consultant for the Organization for Security and Cooperation in
Europe in Vienna and Bosnia-Herzegovina. Ms. Knobler has also worked as a
research and negotiations analyst in Israel and Palestine. She is currently a mem-
ber of the CBACI Senior Working Group for Health, Security, and U.S. Global
Leadership. Ms. Knobler has conducted research and coauthored published
articles on biological and nuclear weapons control, foreign aid, health in develop-
ing countries, poverty and public assistance, and the Arab–Israeli peace process.

MARJAN NAJAFI, M.P.H., was the research associate for the Forum on
Microbial Threats in the Board on Global Health from March 2001 to November
2003. She also worked with the IOM committee that produced Veterans and Agent
Orange: Update 2000. Ms. Najafi received her undergraduate degrees in chemi-
cal engineering and applied mathematics from the University of Rhode Island.
Subsequently, she served as a public health engineer with the Maryland Depart-
ment of Environment and, later, with the Research Triangle Institute in North
Carolina. After earning a master’s of public health from the Bloomberg School of
Public Health at Johns Hopkins University, she managed a lead-poisoning pre-
vention program in Micronesia, funded by a grant from the U.S. Department of
Health and Human Services. She also studied the effects of cellular phone radia-
tion on human health.

Copyright © National Academy of Sciences. All rights reserved.

The Infectious Etiology of Chronic Diseases: Defining the Relationship, Enhancing the Research, and Mitigating the Effec
http://www.nap.edu/catalog/11026.html

Copyright © National Academy of Sciences. All rights reserved.