Overlapping Genes

Dr Tony Southall
[email protected]
OBJECTIVES

• Understand that genes may be organised in genomes in a complex

spatial arrangement

• Be able to discuss frameshifting mechanisms (with examples)

• Understand potential advantages and disadvantages of overlapping

• Be able to describe how overlapping antisense genes can regulate

each other (with examples)
Introduction

Overlapping gene: ‘Adjacent genes, located on either DNA strand, sharing one or
more nucleotides in coding sequence’

• Can code 2 or more(!) proteins using the same DNA sequence

• An imprecise definition?
• What about regulatory regions/non-protein coding genes?

• 1st reported in 1976 in ssDNA genome phages

• Originally thought to be rare
• Now found in mitochondria, microbes & eukaryotes
• Humans (10% of genes are overlapping)
• Arabidopsis (14% of 25,000 genes)
Types of Overlap
Remember:
There are 2 strands of DNA in a helix so we have two “sites” of overlap.

• Same-strand overlapping:
• Called ‘uni-directional’
• 3’ end of one gene overlaps with 5’ of other
• The genes may be regulated by a common promoter
• Common in bacteria PMID: 12047938

• Different-strand overlapping
• 2 categories:
• ‘Convergent’
• 3’ end overlap

• ‘Divergent’
• 5’ ends overlap
• Bidirectional promoters active?
Types of Overlap contd.

• The genomic distribution of these gene pairs is species specific

• e.g. Convergent gene pairs are prevalent in Drosophila but rarer in human and mouse
• May depend on evolutionary constraints

• We also see authors using:

‘Complete’/`Internal’/`Embedded’/ `Nested’ Overlaps
- Useful for discussing eukaryotes (see next slide)
5’ 3’ 5’ 3’
e.g. P P
3’ 5’
P P
5’ 3’
(Same Strand Nested) (Different Strand Nested)

‘Partial’ or ‘Terminal’ Overlaps

Ÿ Involving only small 5’ or 3’ overlap of coding sequence.

Confusingly some older papers use the term ‘out of phase’ to mean much deeper overlaps
“Examples”

Genes sharing the same locus on the

same strand, however coding for
different proteins

Genes sharing promoter region

Nested gene

Embedded gene

Genes on opposite strands with overlapping

locus but no overlap in the exonic region

Tail-to-tail overlap in the exonic region

Head-to-head overlap involving 3ʹ-UTRs

and coding sequence

PMID: 15680581
Gene “Phase”

• We have to consider the relative ‘phase’ that the overlapping genes exist in relative
to one another.
5’ 3’
ATGCGTTTCATGAAATGTCGTGGTTTTGCGTGTCCG

• One gene is considered the ‘reference gene’ – base comparisons from that

• If overlapping genes result in coincident reading frames then= ‘In Phase’

5’ 3’
ATGCGTTTCATGAAATGTCGTGGTTTTGCGTGTCCG
Reference Gene
Gene 2
“In Phase Overlaps”

• Common in bacteria and viruses

• 2 categories: Involving different initiation and different termination of translation

• “Initiation”:
• Alternative translation start site?
• New internal promoter formation
• Genes share terminator
• Dissimilar N-terminals
• Identical C-terminals
• “Termination”:
• Bind same substrate but catalyse
• Same initiator codon
different reactions?
• Termination at distinct codons
• e.g. CS3 Pili genes in E. coli
• 5 polypeptides
• Thermus flavus
Aspartokinase

• askA: α subunit (405 aa)

• askB (3’ end of askA):

β subunit (161 aa)
“Out of Phase Overlaps”

• Some genes overlap in ways that don’t result in identical reading frames

• If both are Phase 0 then they are considered ‘in phase’

• Common in prokaryotes
• Common with phages
• Short overlaps often in phase 2, large overlaps in phase 1 (due to genetic code probabilities)

• Different strand out of phase overlaps:

- In prokaryotes different strand overlaps
seem evenly distributed between phases
“Out of Phase Overlaps”

• The two products of the mouse Ink4a/Arf locus

• Alternative first exons (1α and 1β) that are transcribed from different promoters
• These are spliced to the same acceptor site in exon 2, which is translated in
alternative frames
• Both are key tumour suppressors
PMID: 11584300
Partial Overlap of Genes

• Partial or Terminal Overlap:

• Small overlaps on 5’ or 3’ end
• Common for prokaryotes with functionally dependent genes
• Terminator site of 1 gene overlaps with initiator of another

Tryptophan biosynthesis genes

• Tryptophan operon is an example:

• trpE-trpD- one base overlap:

• Same with trpB-trpA (Shine Dalgarno sequence within trpB)

• Proteins synthesised in equimolar ratios
• Translation coupling dependent on this overlap (PMID: 2685759)
• Proximity of the trpB stop codon to the trpA start influences trpA translation
Summary
• Genes can overlap in all ways you could have thought possible!
Translational recoding
• Ribosomes can be directed to:
• utilise alternative start sites
• bypass or recode termination codons
• Or site specific ‘Programmed Shift of Reading Frame (PSRF)’

• Ribosomal Frameshift:
• Ribosome pause on mRNA: moves or 1 nucleotide before continuing
• ˃ 1 protein per mRNA
• Not every ribosome may shift!

• Depends on:
• mRNA regulatory sequence & structure
• Remember all mRNA structure must be unfolded
• Affect codon/anti-codon binding and leads to uncoupling
-1 Programmed Ribosomal
Frameshifting
• Very common in prokaryotes
• mRNA requires:

i) ‘Slippery’ sequence
• 7 nucleotides (where shift takes place)
X XXY YYZ (original reading frame)
XXX YYY Z (shifted reading frame)
XXX: 3 identical nucleotides, YYY: AAA/UUU, Z: not often G

ii) spacer sequence - 12 nucleotides or less

iii) downstream ‘stimulatory’ structure

• pseudoknots, kissing stem loop
• energetic barrier
• aids positioning over slippery site
-1 Programmed Ribosomal
Frameshifting contd.

• Slippage may occur during distinct points of translation elongation cycle:

• During accommodation of the A-site tRNA
• Or just after before peptidyl transfer
• Or during EF-G catalysed translocation
-1 Programmed Ribosomal
Frameshifting contd.

PMID: 9586242
+1 PRF example
• Saccharomyces cerevisiae: OAZ1
- Mammalian equivalent: ornithine decarboxylase antizyme (OAZ)
- Ornithine decarboxylase (ODC) produces polyamines
- OAZ stimulates ubiquitin-independent degradation of ODC
- polyamines stabilise pseudoknot: +1 PRF and antizyme
+1 PRF example (cont.)

OAZ promotes ODC ODC increases

degradation polyamine levels
of ODC

Frameshift allows
production of Polyamines stabilise
functional OAZ pseudoknot in OAZ
protein mRNA

Induction of +1 PRF
on OAZ mRNA

Negative feedback loop!

-1 PRF example

• Gag is produced as a 55kDa

precursor protein that forms the virus
particle

• The 160kDa GagPol polyprotein

precursor containing the viral enzymes
protease, reverse transcriptase and -1 PRF
integrase — is also expressed at ~5% of
the level of Gag

• Due to a -1 programmed ribosomal

frameshifting event!

Figure adapted from

PMID: 26119571
-1 PRF example (cont.)
-1 PRF example (cont.)

Targeting PRF with drugs?

Images by James Brisbois PMID: 24387306

Overlapping genes
and Programmed Ribosome Frameshifting
Why?!
• Allows for genome compression (see next slide)

• PRF provides another method to increase the diversity of the proteome

PRF and protein diversity

• Stoichiometry: PRF and shared promoters allow proteins to be

expressed at stable levels relative to each other – coordinated control
Advantages of overlapping genes
• Genome size

• Viruses:

• Small genome size / genome compression

• Useful as Capsid enforces limitations on virus:
• Can’t package larger genome (PMID: 20610432)

• Especially with icosahedral capsid

• Can only increase size only with increased subunit number
• Fitness cost (eg. host cell resources and replication speed)

• Genome replication - Faster so can out compete other viruses?

Advantages/disadvantages of overlapping genes
• Mutations and evolution

• Mutations - in theory, might mitigate the detrimental effects of mutation (PMID: 20610432)

Disadvantage:

• Evolution – overlapping genes may be subject to evolutionary constraint

Difference between prokaryotes
and eukaryotes

• Eukaryotes:
• Have larger genomes
• Contain introns so overlapping genes may be located in introns
• More abundant different strand overlaps:
• A result of a more complex genome structure?
• Avoidance of exon sharing retains flexibility?
• A lower proportion of divergent different strand overlaps
• 5’ region delicate?

• Prokaryotes:
• Features exons primarily so exon overlapping is common
• Unidirectional overlapping is the most common layout
• operons a driving force?
• PRF move prevalent? Selected for more due to genome size restraints?
Genes can be overlapping for:

i) Genome compression
ii) Sharing promoters
iii) Stoichiometry

Why else might they be

overlapping?
Graphic: Christine Daniloff
Gene regulation by
antisense transcription

Anitsense transcription can impact on gene expression at 3 different stages:

1) Transcription initiation

2) During transcription

3) Post transcription
Gene regulation by antisense transcription

1) Transcription initiation

Example:

Image adapted from PMID: 24217315

Gene regulation by antisense transcription
Gene regulation by antisense transcription

3) Post transcription

Example:

Image adapted from PMID: 24217315

Gene regulation by antisense transcription

Sense–antisense pairs as self-regulatory circuits

Fine tuning – antisense expression slightly modulates expression of the sense gene

Bistable switch – strong mutual repression

Image adapted from PMID: 24217315

Summary

• Overlapping genes may be on the same strand or different strand

• Different strand overlaps may be convergent or divergent

• Same strand overlaps may express themselves via Programmed

Ribosomal Frameshifting (PRF)

• Benefits include smaller genome size and faster replication

• Anti-sense transcription can regulate sense gene expression by multiple

mechanisms
References
This lecture is based upon one previously given by Dr Timothy Simpson
and Dr Rey Carabeo (both formerly Imperial College London).

Key references:

• Makalowska, I et al., (2005) Overlapping genes in vertebrate genomes. Computational Biology and Chemistry 29:1-12

• Dinman, J.D. (2013) Mechanisms and implications of programmed translational frameshifting. Wiley Interdisciplinary reviews. RNA. 3
(5):661-673

• Chirico et al. (2010) Why genes overlap in viruses 22;277(1701):3809-17.

• Vicent Pelechano and Lars M. Steinmetz (2013) Gene regulation by antisense transcription. Nature Reviews Genetics 14:880-893

Ribosome reinitiation: http://www.intechopen.com/source/html/19010/media/image2.png

Polysome electron micrograph: http://www.nobelprize.org/educational/medicine/dna/a/translation/pics_em/polysome.gif
Prokaryote and eukaryote cells: http://g11-biob1-2011-12.wikispaces.com/file/view/,nb.png/253502728/720x454/,nb.png
Ribosome: http://barleyworld.org/sites/default/files/figure-09-15b.jpg
Virus: https://upload.wikimedia.org/wikipedia/commons/c/c0/CowpeaMosaicVirus3D.png
Term Table

In the literature different authors (especially considering the year the article was
published in!) may use different pieces of terminology to discuss the same thing.
Therefore, here is a table to simplify things for you

Uni-directional Convergent Divergent

Same-strand Tail-to-tail Head-to-head
Co-directed Anti-parallel Head-on
Parallel End-on
Tandem