Scribd
Upload
73 views5 pages

Problem Sheet BIOL1XX7 Module1 2021

This document contains a problem sheet with questions from Modules 1-7 of the course. The questions are divided into parts A and B, with part A focusing on lectures 2-4 and part B on lectures 5-7. The questions cover topics like the key characteristics of life, biomolecules, DNA and RNA structure, the central dogma, DNA replication, transcription, translation, protein structure, enzyme kinetics, and driving biochemical reactions. Students are encouraged to attempt the questions in preparation for live Q&A sessions to discuss select questions.

Uploaded by

Jui-Chi Chen
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as DOCX, PDF, TXT or read online on Scribd
73 views5 pages

Problem Sheet BIOL1XX7 Module1 2021

This document contains a problem sheet with questions from Modules 1-7 of the course. The questions are divided into parts A and B, with part A focusing on lectures 2-4 and part B on lectures 5-7. The questions cover topics like the key characteristics of life, biomolecules, DNA and RNA structure, the central dogma, DNA replication, transcription, translation, protein structure, enzyme kinetics, and driving biochemical reactions. Students are encouraged to attempt the questions in preparation for live Q&A sessions to discuss select questions.

Uploaded by

Jui-Chi Chen
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as DOCX, PDF, TXT or read online on Scribd
You are on page 1/ 5

Problem Sheet Module 1

For each Lecture questions that focus on part A should be above the **** and part B below the
line. Try these out, the plan is to go over some these questions in the Live Q&A sessions (there will
be an upvoting option available on canvas in Padlet to vote for which questions – if for some
reason that doesn’t work properly will use a Zoom poll at the beginning of the session) focussing
on lectures 2-4 in the first Q&A session and 5-7 in the second session (with room for other
questions from anywhere in the second half of each Q&A).

Lecture 2

1) What are the key characteristics of Life?


2) Classify these organisms as prokaryotic or eukaryotic: humans, mushrooms, fish, bacteria,
algae, gum trees
3) What properties of carbon make it central to life as we know it (i.e. carbon-based life)?
4) What are the 6 most common elements in living things, and are they each usually polar or
hydrophobic?
5) True or false: Hydrophobic things like to be in aqueous (water-based) environments.
6) Which of these types of molecules is mostly hydrophobic and which are mostly polar?

A) B) C)

D) E) F)

**********************

7) What are the five main types of molecules used in Biology and what are their uses?

8) True or False: The only role of Sugars/Carbohydrates is as energy sources?

9) Name three functions of lipids.

10) What are the differences between amino acids and nucleotides?

11) What chemical properties can different amino acids have (name at least 3)?
Lecture 3

1) Match the end to the biopolymer type to indicate the direction.

Biopolymer type End


Nucleic acid/ Protein C-terminal, 5’, N-terminal,3’

2) What type of sequence is each of the following (DNA/RNA/Protein)?


A. AATTCGCGCTCTAGCT
B. AAHWYLDDEEPNQGS
C. AAUUCGCGCUCUAGCU
3) Sketch a single stranded generic nucleic acid sequence to show the arrangement of sugars,
phosphates and nucleobases (you don’t need to show the chemical formulas –
square/triangles/circles or similar is fine).

*******

4) Which nucleobases basepair with each other (A,C,G,T,U), which are considered to have
stronger basepairing and why?
5) What properties of RNA mean that it is less suitable as a source of genetic material than
DNA?
6) Make a sketch of the dsDNA helix (B-DNA) showing (and labelling) the following features (NB
not asking for chemical formula or precise dimensions etc just enough detail so that you can
point out where these features appear):
A. sugar-phosphate backbone
B. Base-pairing
C. Base-stacking
D. Major groove
E. Minor groove
F. Directions of each strand

Lecture 4

1) According to the central dogma of molecular biology, which of the following flows of
information can take place directly in biology?
A. DNA to RNA
B. Protein to RNA
C. DNA to Protein
D. DNA to DNA
E. RNA to DNA
F. Protein to DNA
G. Protein to Protein
H. RNA to RNA
2) Match the type of information containing biopolymer to its main role in the central dogma
of Molecular Biology:

Molecule Role
1. DNA A. Doing molecules
2. RNA B. Genetic Store
3. Protein C. Messenger
3) Consider muscle cells and skin cells from the same individual. In general terms describe the
genome, transcriptome and proteome for each cell type (are they the same or different and
if different how/why are they different).
4) What are the main differences between genomes and chromosomes from bacteria and
eukaryotes?

*******

5) What is the “start codon” and what amino acid does it encode?
6) What peptide sequence does the following mRNA sequence encode [hint: find the start
codon first and use the codon table above]?
UCAUGGGUUGGACUCUUUAACCG

7) What would be the effect on the peptide of the following mutations?


UCAUGGGUUGGACUCUAUAACCG
UCAUGGGUUCGACUCUUUAACCG
UCAUG--UUGGACUCUUUAACCG (2-base pair deletion)
UCAUGGGUUGGACUCUUUACCCG
UCAUCGGUUGGACUCUUUAACCG

Lecture 5

1) What does semi-conservative replication mean?


2) What are the main challenges in copying DNA from DNA and how are they overcome?
3) What are the roles of the following proteins in DNA replication: DNA polymerase, gyrase,
helicase, ligase, primase?

********

4) How are RNA polymerases different from DNA polymerases?


5) What are the signals for transcription initiation and termination?
6) How can different genes be transcribed into RNA at different rates?

Lecture 6

1) How do tRNA and aminoacyl RNA synthetases work together to correctly translate an mRNA
sequence translated into a protein/peptide sequence?
2) What roles does the ribosome have in protein synthesis initiation, elongation and
termination?
3) True or False: Release Factor is a tRNA that binds to the stop codon to terminate protein
synthesis

********************

4) What are the differences between primary, secondary, tertiary and quaternary structure of
proteins?
5) What types of bonds and forces hold protein structure held together?
6) Describe how an element of protein secondary structure can complement dsDNA structure
to allow protein-DNA interactions.

Lecture 7

1) If a reaction is at equilibrium which of the following statements is true?


a. The reaction is favourable
b. Substrate molecules are probably exchanging with product molecules and vice versa
c. The total energy of the substrate population is higher than the product population

2) What does it mean if a reaction is under kinetic rather than thermodynamic control?
3) True or False? A reaction (Substrate <-> Product) can be driven to the right by adding more
substrate or removing the product.

******

4) Consider this graph from Lecture 7B where we saw faster initial reaction rates when twice as
much enzyme was added. What would happen to these two curves if we let the reactions
run for a long time?
5) What are three properties of enzymes that are important for biology and/or medicine?
6) How can the hydrolysis of pyrophosphate drive unfavourable interactions?

You might also like